ID: 1181930601

View in Genome Browser
Species Human (GRCh38)
Location 22:26397960-26397982
Sequence GCTTAAGGAGATGTGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181930592_1181930601 26 Left 1181930592 22:26397911-26397933 CCTTCACAGAATTGAAGAGAGAT No data
Right 1181930601 22:26397960-26397982 GCTTAAGGAGATGTGGTGGCTGG No data
1181930596_1181930601 -1 Left 1181930596 22:26397938-26397960 CCTTGCTCTTAATTAGGCTTTGG No data
Right 1181930601 22:26397960-26397982 GCTTAAGGAGATGTGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181930601 Original CRISPR GCTTAAGGAGATGTGGTGGC TGG Intergenic
No off target data available for this crispr