ID: 1181934560

View in Genome Browser
Species Human (GRCh38)
Location 22:26429426-26429448
Sequence GACGCCGCCGCCCGAGGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181934560_1181934565 -10 Left 1181934560 22:26429426-26429448 CCGCGCCCTCGGGCGGCGGCGTC 0: 1
1: 0
2: 1
3: 28
4: 194
Right 1181934565 22:26429439-26429461 CGGCGGCGTCTCCTGGGTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 186
1181934560_1181934570 10 Left 1181934560 22:26429426-26429448 CCGCGCCCTCGGGCGGCGGCGTC 0: 1
1: 0
2: 1
3: 28
4: 194
Right 1181934570 22:26429459-26429481 CGGCAGCCGTCCGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 138
1181934560_1181934572 16 Left 1181934560 22:26429426-26429448 CCGCGCCCTCGGGCGGCGGCGTC 0: 1
1: 0
2: 1
3: 28
4: 194
Right 1181934572 22:26429465-26429487 CCGTCCGCGCGCCCGGGCGCAGG 0: 1
1: 0
2: 0
3: 23
4: 204
1181934560_1181934569 9 Left 1181934560 22:26429426-26429448 CCGCGCCCTCGGGCGGCGGCGTC 0: 1
1: 0
2: 1
3: 28
4: 194
Right 1181934569 22:26429458-26429480 CCGGCAGCCGTCCGCGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181934560 Original CRISPR GACGCCGCCGCCCGAGGGCG CGG (reversed) Exonic
900135699 1:1116091-1116113 GGCGCCACCGCCTGAGGGCGGGG - Exonic
900251332 1:1671673-1671695 GACGCTCCCTCCCGAGGGCCAGG + Intronic
900690223 1:3976395-3976417 GAAGCCGCGTCCCGAGGGCCTGG + Intergenic
902323695 1:15684667-15684689 GAGAGCGCCGCCGGAGGGCGTGG - Intronic
903349833 1:22710949-22710971 GGCGCCGCGGCCCGAGGCCCCGG + Exonic
903923395 1:26817332-26817354 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
904794795 1:33051202-33051224 GCCGCCGCCGCCCGACCGCCGGG + Intronic
905584399 1:39105550-39105572 GCCGCCGCCGCCTCAGCGCGCGG + Intronic
905806983 1:40884385-40884407 GCCGCCGCCGCCCGCGGCAGAGG + Intergenic
906436899 1:45803928-45803950 GCCGCCGCCGCCCGACCGCCGGG + Exonic
906486625 1:46240363-46240385 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
906960915 1:50419092-50419114 GCCGCCGCCGCCGGGGGGCCTGG - Exonic
907364168 1:53945975-53945997 GAGGCCGCCGCGAGGGGGCGGGG - Intergenic
910200144 1:84690552-84690574 GGCGCCGGCGCGCGGGGGCGGGG - Intronic
910892234 1:92030066-92030088 GCCGCCGCCTCCCAATGGCGAGG + Exonic
911116113 1:94247807-94247829 GACCCCGCCCCCCGGGAGCGCGG - Intronic
912481500 1:109985070-109985092 GATGCCGCTGCCCGGGGTCGGGG + Exonic
915238270 1:154501838-154501860 GCCGCCGCCGCCCCCGGGCTTGG + Exonic
920029198 1:203026495-203026517 GCCTCCGCCGCCCAAGCGCGCGG - Intronic
922558255 1:226549140-226549162 CACCCCGCCGCGGGAGGGCGTGG + Intronic
924624770 1:245688886-245688908 GACGCCCCCTCCCCAGGGCACGG - Intronic
924624798 1:245688967-245688989 GACGCCCCCTCCCCAGGGCACGG - Intronic
924775160 1:247111336-247111358 GGCGCCGCAGCCCCAGCGCGCGG + Exonic
1063664097 10:8051501-8051523 GCCGCCGCCGCCGCAGGGCCCGG - Intergenic
1064208965 10:13347769-13347791 GCCGCCGCCGCGCGGGGCCGGGG - Intronic
1064209074 10:13348106-13348128 GCCGCCGCCGCCGCCGGGCGCGG - Exonic
1065099522 10:22320608-22320630 GCCTCGGCCGCCCGCGGGCGGGG + Intronic
1066022837 10:31319818-31319840 GACGGCGCCGGCCGGGGCCGCGG - Intronic
1071545020 10:86522174-86522196 GAGGCCGCCGCCCGGGAGCTGGG + Intergenic
1072950151 10:99840239-99840261 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1073503845 10:103967060-103967082 GACGCCCCCACGCGAGCGCGCGG + Intergenic
1074801440 10:117004971-117004993 GCAGCCGCGGCCCGTGGGCGGGG - Intronic
1076721664 10:132395964-132395986 CGCGCGGCCGCCGGAGGGCGAGG + Intergenic
1077445827 11:2590389-2590411 GAAGCCCCCGTCCCAGGGCGTGG + Intronic
1081812892 11:45923146-45923168 GCCGCCGCCGCCCAAGTGCGAGG + Exonic
1083970207 11:66070049-66070071 GCCGCGGCCGGCCGTGGGCGGGG + Intergenic
1084418786 11:69049789-69049811 GAATCCGCCCCCCGAGGGTGGGG + Intronic
1085332776 11:75667574-75667596 GACGCCGCTGCCCGCGGCCCAGG - Exonic
1085522256 11:77145700-77145722 CACGCAGCCTCCCCAGGGCGAGG - Intronic
1089293968 11:117457192-117457214 GGCGCCGCCTCCCGAAGGTGAGG + Intronic
1090344994 11:126062653-126062675 GCCGCCGCCGCGCGCGCGCGGGG - Intronic
1091616086 12:2052576-2052598 GACGCCGCCGGCGGGGCGCGAGG + Intronic
1091762470 12:3096108-3096130 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1095439318 12:42227061-42227083 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1096022510 12:48333877-48333899 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1096191540 12:49623361-49623383 GACGCGGCGGCGCGGGGGCGGGG + Intronic
1097107693 12:56635027-56635049 GCCGCCGCCGGCCCAGGGCTGGG - Intronic
1098769723 12:74537991-74538013 GACCCCGCCGCCGGAGGACTGGG + Exonic
1100565631 12:95790916-95790938 GCCGCTGCCGCCCGGGGGGGGGG + Intronic
1102679694 12:114683047-114683069 GACGCTGCCTCCCAACGGCGCGG - Exonic
1104667546 12:130658021-130658043 GACGCTGCCTCCCAAGGGCTTGG + Intronic
1106340242 13:28820239-28820261 GCCGCCCCCGCTCGAGGGCCGGG - Intergenic
1111950817 13:94707709-94707731 GACGCTGTCGCGCGAGGGGGTGG - Intergenic
1112290909 13:98143403-98143425 GCCCCCGGCGGCCGAGGGCGCGG - Intronic
1112652639 13:101416098-101416120 GGCGCCTCCACCCGAGAGCGGGG - Intronic
1113494031 13:110713945-110713967 GACCCCAGCGCCTGAGGGCGCGG - Intronic
1113861581 13:113490734-113490756 GCCGCGGCCGTCCGAGGACGAGG - Exonic
1116958145 14:50944536-50944558 GACGGCACCGCCCGAGGGGGCGG - Exonic
1117424718 14:55581239-55581261 GACGCCGCTGCCCGCGTCCGGGG - Intronic
1119189413 14:72670226-72670248 GACTCCACCACCCGAGGCCGAGG - Exonic
1122214316 14:100193151-100193173 GACACCTCGGCCAGAGGGCGGGG + Intergenic
1122399716 14:101459303-101459325 TCTGCCGCCGCCCGAGCGCGCGG - Intergenic
1122582075 14:102777376-102777398 GCCCCCGCCGCCCGCGCGCGTGG - Intergenic
1122964049 14:105112809-105112831 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1123880752 15:24676084-24676106 GCGGCCGCAGCCCGAGGGAGAGG - Exonic
1127293731 15:57592060-57592082 GGCGGCGCCGCCCGAGAGCAGGG - Exonic
1129189181 15:73927572-73927594 GCCGCCGCCCCCCGACGGCCTGG + Exonic
1129339108 15:74873377-74873399 GATGCCCTCCCCCGAGGGCGTGG + Intergenic
1132055308 15:98647669-98647691 GCGGCGGCCGCCAGAGGGCGCGG - Intergenic
1132555446 16:570059-570081 GACCCCGCCGCCCGAGCGCGCGG + Exonic
1133040930 16:3059420-3059442 GACCCCGCCTCCCGAGCCCGGGG + Exonic
1133104851 16:3500850-3500872 GACGCCGAGGGCAGAGGGCGTGG - Intergenic
1135607391 16:23836196-23836218 GCCGCCGCCGAGCGAGGGCGAGG + Exonic
1137288710 16:47037483-47037505 GAAGGCGCCACCCGAGGGCCTGG - Intergenic
1138016655 16:53434593-53434615 GCTGCCGCCGCCGGAGGGGGAGG - Exonic
1138178689 16:54928730-54928752 GACGGCGCGGCCAGAGGGCCTGG + Intergenic
1141532637 16:84657461-84657483 GACGCAGCAGCCCGAGCGCGAGG + Exonic
1145205640 17:20983902-20983924 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1147819129 17:43231429-43231451 TACTTCGCCGCCCGAGGGCGGGG + Intergenic
1147819712 17:43234452-43234474 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147821024 17:43241850-43241872 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147821830 17:43246339-43246361 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147826563 17:43273765-43273787 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147827452 17:43278643-43278665 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147828560 17:43284804-43284826 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147829668 17:43290955-43290977 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147831446 17:43300706-43300728 TACTTCGCCGCCCGCGGGCGGGG + Intergenic
1147963157 17:44179904-44179926 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1147967138 17:44199538-44199560 GTCGCCGCCGCCGGAGGACGCGG - Intronic
1148826462 17:50397621-50397643 GTCGCCGCCGCCGGAGGGGTGGG + Intergenic
1149908700 17:60550736-60550758 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1151674127 17:75589218-75589240 GCGGCGGCCGCCAGAGGGCGAGG + Intergenic
1152392342 17:80010317-80010339 GGAGCCGCGGCCCGAGGCCGGGG - Exonic
1152861279 17:82698212-82698234 GACGCCGCAGCACGAGGGCCAGG + Intronic
1157550201 18:48576071-48576093 GGCGCCGCTGCCCGAGGACCGGG - Intronic
1158954118 18:62523466-62523488 GGAGCCGCCGCCCGAGGCGGAGG + Exonic
1159241726 18:65750901-65750923 GCCCCCGGCGCCCGAGGCCGGGG + Exonic
1159586880 18:70289673-70289695 GACGCCCCCGCCCCACCGCGAGG + Intronic
1160703654 19:519321-519343 GCCGCCGCCCCCCGACGGCGCGG - Exonic
1160795006 19:941148-941170 CACGCGGCAGCCCGAGGGAGCGG + Intronic
1160914696 19:1491017-1491039 GACCCCGCCGGGAGAGGGCGGGG - Exonic
1161401200 19:4066804-4066826 GACGCCGCCGCCGCCGCGCGAGG - Exonic
1161802683 19:6424644-6424666 GCCGCCGCCGCCCGCCGGCGGGG - Exonic
1162809123 19:13153768-13153790 GACGGCGCCGCCCGCGTGCGAGG + Exonic
1162861121 19:13506368-13506390 GCCGCCGCCGCCCGATGGGCTGG - Intronic
1164653367 19:29901815-29901837 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1165199813 19:34134540-34134562 TGCGCCTGCGCCCGAGGGCGCGG + Intergenic
1165463620 19:35959237-35959259 GACGTCGCGGCCCGAGGAAGTGG + Intergenic
1165757991 19:38305152-38305174 CAGGCCACCGCCCCAGGGCGTGG - Exonic
1166094451 19:40530446-40530468 GCGGCCGCCGCGCGGGGGCGAGG + Intronic
1166261410 19:41644132-41644154 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1167110355 19:47457114-47457136 GGCGGCGCCGGCCGAGGGCGCGG - Exonic
1167428423 19:49441435-49441457 GACGCGGCCGCCCGGGCCCGCGG - Exonic
1168145732 19:54419249-54419271 GACGCAGCCTCCCCCGGGCGAGG - Exonic
1168154027 19:54463384-54463406 GGCGCCGGCGCCCCAGGGTGGGG + Exonic
1168649471 19:58084591-58084613 GAAGCCGCCACCCAGGGGCGTGG + Exonic
926914339 2:17878501-17878523 GGCGCCCCGGGCCGAGGGCGCGG - Intronic
934079048 2:88452271-88452293 GCCGCCGCCCCCCGGGGCCGCGG - Exonic
935971624 2:108534735-108534757 CACGCCGCCACCCGAGCGCTGGG - Intronic
936038398 2:109129980-109130002 GCCCCCGCCGCCCGCGAGCGTGG - Exonic
936433186 2:112482014-112482036 GCCGCCGCCGCCCCCGGGGGAGG + Intergenic
943669791 2:190648856-190648878 GCCGCCGCCGGGCGGGGGCGGGG - Intronic
943811624 2:192195212-192195234 GACGCCCCCTACCGAAGGCGGGG + Exonic
944547319 2:200811529-200811551 GAAGTCGAAGCCCGAGGGCGGGG - Intronic
944715984 2:202376452-202376474 GGCGTCGCGGACCGAGGGCGGGG - Intergenic
946692395 2:222319453-222319475 GCCGCCGCCTGCCGAGGACGCGG - Intergenic
948479591 2:238241128-238241150 CAGGACGCTGCCCGAGGGCGCGG - Intergenic
948738230 2:240025126-240025148 GGAGCCGCCGCCAGAGGCCGGGG + Intronic
1168913307 20:1467008-1467030 GCCGCGGTCGCCAGAGGGCGCGG - Intronic
1168963938 20:1887503-1887525 GGCTCCGCCACCCGAGGGCCTGG - Intergenic
1169214733 20:3786517-3786539 GCCGCCGCCGCCCCGGGGCGGGG + Exonic
1171173609 20:23035498-23035520 GACGCTGCCCCCCGGGGGCGAGG + Exonic
1176143211 20:63554093-63554115 GACGCTGCGGCCCGGGGGCGGGG - Exonic
1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG + Exonic
1179190561 21:39118801-39118823 GAAGCCGCCTCCCCATGGCGGGG - Intergenic
1179511816 21:41878805-41878827 GACGACGCCGCCCGGCGGCGGGG + Exonic
1179663573 21:42893600-42893622 GCCGCCGCTGCCCGAGGCCCAGG + Intronic
1181026844 22:20131791-20131813 GCCGCCGCCGCCCGTGGGGTGGG + Intronic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1182623466 22:31630325-31630347 GAGGGCGGCGCCCGAGGGCCAGG - Intronic
1183845077 22:40536326-40536348 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1184670111 22:46007866-46007888 GACGCCACCGCACAAGGGCCTGG - Intergenic
1184831879 22:46993934-46993956 GGCCCCACCCCCCGAGGGCGAGG - Intronic
952382888 3:32818196-32818218 GCCGCCGCCCCCCGACGACGTGG - Exonic
953404830 3:42654971-42654993 GACGGCGCCGCCCTCGGGCTGGG + Intronic
954080492 3:48210750-48210772 GCCGCCGCCGCCCGACCGCCAGG + Intergenic
954446721 3:50550769-50550791 GACACCGCTGCCTGGGGGCGAGG - Intergenic
955916398 3:63912351-63912373 CCCGCGGCCGCCCGAGGGAGGGG - Intronic
959419621 3:106112747-106112769 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
959941597 3:112086649-112086671 GACGGCGCCGAGCGAGGGTGGGG + Intronic
961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG + Intronic
965962056 3:174440906-174440928 GGGGCCGCCGCTCGGGGGCGAGG + Intronic
966362834 3:179148537-179148559 GCCGCCGCCGCCCGCGGGGCTGG + Exonic
968377258 4:53750-53772 GACGCCGGCGCCCGCGTGCGAGG + Intronic
968578800 4:1380233-1380255 GAGGCCGTGGCCCGAGGGCGGGG + Intronic
972396520 4:38663732-38663754 CGCGCCGCCGCCCGAGCCCGGGG - Intergenic
975118429 4:70704711-70704733 GACCGCCCCGCCCGACGGCGCGG - Intronic
982616133 4:157637867-157637889 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
990308583 5:54517717-54517739 GCCGCCGCCGGTCGGGGGCGGGG - Intergenic
992373686 5:76170962-76170984 GCCGCCGCCGCCCGACCGCCGGG + Intronic
992690391 5:79236028-79236050 GGCGCCGGCGCGCGCGGGCGGGG + Intronic
995052737 5:107724770-107724792 GCCGCCGCCGCCGGGGGCCGGGG - Intergenic
996404297 5:123090646-123090668 GGCGCCGGCGCCGGCGGGCGCGG + Intronic
997319156 5:132963576-132963598 GTCGCCGCCGCCAGCGGACGGGG - Exonic
997470503 5:134114675-134114697 GGCGCCGCCGGCCGAGTGCCGGG - Intergenic
999768110 5:154755844-154755866 GCCGCCGGCGCCCGAGGGCAAGG + Intronic
999782047 5:154857794-154857816 GACGGCGCCTCCCGTGGGCACGG - Intronic
1000985213 5:167858732-167858754 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1002055810 5:176597398-176597420 GCCGCCGCCGCGCGAGGACGCGG - Exonic
1002186166 5:177455779-177455801 GCCGCCGCCGCCCTATAGCGAGG + Exonic
1002341446 5:178518916-178518938 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1002512584 5:179732721-179732743 GAACCGGCCGCCCGAGGGCGTGG - Intergenic
1002580940 5:180209140-180209162 GCCGCCGCCGCCCGACCGCCCGG + Intronic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1005569831 6:27133982-27134004 GACGCCGCTGCACGAGAGCGAGG + Exonic
1006300960 6:33193310-33193332 GGCGCCGCCGCCCGCTGGCGCGG + Intergenic
1006492097 6:34396882-34396904 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1007625368 6:43243571-43243593 GCCGCCGCCGCCGGAGGGAGCGG + Intergenic
1007674461 6:43581666-43581688 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1011640447 6:89412203-89412225 GACTCCTCCGCCGGCGGGCGGGG - Exonic
1014137732 6:117907906-117907928 GGCGGCGCCGGGCGAGGGCGCGG + Intronic
1015476505 6:133664192-133664214 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1015842419 6:137489251-137489273 GGAGCCGCCGCTCGAGGGCTGGG - Intergenic
1016462003 6:144286960-144286982 GTCGCCGCGGCCAGAGCGCGCGG + Intronic
1017672203 6:156778576-156778598 GCCGCCGCCGCCCCCGGGCACGG - Exonic
1018727999 6:166627970-166627992 GACAAAGGCGCCCGAGGGCGGGG + Intronic
1018891531 6:167986334-167986356 GACGCCGCCGCCGCAGGACAGGG - Intergenic
1019475689 7:1242993-1243015 GAAGCCGGCGCGCGAGGGCCCGG - Intergenic
1019578011 7:1746765-1746787 GCCGCCTCCGCACGAGGGCCTGG + Exonic
1021872114 7:25017857-25017879 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1029366396 7:100119268-100119290 GCCCCCGCCACCCGAGCGCGGGG + Intronic
1032194005 7:129779595-129779617 GGCGCCTCCGCCTGAAGGCGCGG + Intergenic
1034218126 7:149423103-149423125 GGGGTCGCCGCCCGCGGGCGCGG + Intergenic
1035508139 8:150703-150725 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1035637778 8:1160104-1160126 GACGCCGCGGCCCGTGGGTTCGG + Intergenic
1036466562 8:9003123-9003145 GTCGCCGCGGCCGGAGGGCGGGG + Exonic
1036536903 8:9658414-9658436 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1037273791 8:17156675-17156697 TCCGCCGCCGCCCGCGGGCCTGG - Exonic
1038157263 8:25001705-25001727 GACGCCGCCGCCCGCGCGCCAGG + Intergenic
1038176382 8:25184878-25184900 GTCGCCGCCGCCGCGGGGCGAGG + Exonic
1039921526 8:41896994-41897016 GTTCCCGCCGCCCGACGGCGCGG - Intergenic
1040501380 8:48008340-48008362 GACTCCGCCCCCGGCGGGCGCGG - Intergenic
1044660437 8:94590117-94590139 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1047423904 8:124728557-124728579 GCGGCCGCCGCACGCGGGCGGGG + Intergenic
1047687089 8:127315782-127315804 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049693769 8:143973776-143973798 GTCGCGGCCGCCCCTGGGCGGGG - Intronic
1049718223 8:144103732-144103754 GATGGCGCCGCCAGCGGGCGGGG - Exonic
1049828618 8:144685826-144685848 GCCGCCGCCGGCCCAGTGCGCGG + Intergenic
1053457039 9:38241453-38241475 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1056154002 9:83817405-83817427 GTCCCCGCCACCCGAGGCCGGGG + Intronic
1057192596 9:93095977-93095999 GAAGCCGACGCCGGAGGGGGCGG + Intergenic
1058045490 9:100352896-100352918 GACGCGGCCGCGTGAGGACGAGG - Exonic
1059210831 9:112513613-112513635 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1060064750 9:120494966-120494988 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1061984119 9:134119156-134119178 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1062583892 9:137240476-137240498 GACGCCGCGCCCCGAGGGCCGGG - Intergenic
1203571978 Un_KI270744v1:140496-140518 GACGCCGGCGCCCGCGTGCGAGG - Intergenic
1189325693 X:40109512-40109534 GGCTCCGCCGCCCGGGGCCGGGG - Intronic
1189821494 X:44873415-44873437 GTCGCCGCCGCCCGCGGCGGAGG + Intronic
1191618341 X:63190429-63190451 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1192621051 X:72680747-72680769 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1195036350 X:100973487-100973509 GCCGCCGCCGCCCGACCGCCGGG - Intronic