ID: 1181934635

View in Genome Browser
Species Human (GRCh38)
Location 22:26429644-26429666
Sequence GGGCCGGGATGCGGGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 400}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181934635_1181934648 26 Left 1181934635 22:26429644-26429666 CCCGGGCGCCCGCATCCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 400
Right 1181934648 22:26429693-26429715 AAGCGCCGCCGCCTCGGAGCCGG No data
1181934635_1181934649 27 Left 1181934635 22:26429644-26429666 CCCGGGCGCCCGCATCCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 400
Right 1181934649 22:26429694-26429716 AGCGCCGCCGCCTCGGAGCCGGG 0: 1
1: 1
2: 2
3: 18
4: 192
1181934635_1181934647 20 Left 1181934635 22:26429644-26429666 CCCGGGCGCCCGCATCCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 400
Right 1181934647 22:26429687-26429709 CGTGCTAAGCGCCGCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181934635 Original CRISPR GGGCCGGGATGCGGGCGCCC GGG (reversed) Intronic
900122481 1:1054712-1054734 GGGCCGGGAGGCGGGTGCCCAGG + Intronic
900140438 1:1137353-1137375 GGGCCGGGTTTTGGGGGCCCGGG + Intergenic
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900189823 1:1348654-1348676 GGGCCGGGAAGCTGGGGCCAGGG + Intronic
900191914 1:1355678-1355700 GAGCTGGGAGGCGGGCGCCCGGG - Exonic
900214145 1:1472134-1472156 GGCCGGGGAAGCGGGAGCCCTGG + Intronic
900221693 1:1512518-1512540 GGCCGGGGAAGCGGGAGCCCTGG + Intronic
900611635 1:3546828-3546850 GGGCTGGGAAGGGGGCGCCAGGG + Intronic
901506308 1:9688004-9688026 AGGCCTGGCTGCGCGCGCCCTGG + Intronic
901551319 1:9997725-9997747 CGGCCGGGGAGGGGGCGCCCGGG + Intronic
902089643 1:13893097-13893119 GCGCGGGGACGCGGGAGCCCAGG + Intergenic
902350116 1:15847980-15848002 GCGCCGGGAGGCGGGTGCCGGGG - Exonic
902823327 1:18956503-18956525 GGCCCCGGATGCGGGCGCCGAGG + Exonic
903036962 1:20499253-20499275 CGGCCGGGATGCCTGCCCCCTGG - Intergenic
903072208 1:20732073-20732095 GCGGCGGGAAGCGGGCACCCAGG - Intronic
903189884 1:21650609-21650631 GGGCAGGGCTGGGGGCTCCCAGG + Intronic
903654823 1:24942830-24942852 AGGCTGGGAGGCGGGAGCCCGGG - Intronic
904389495 1:30172584-30172606 GAGCAGGGATTCGGGAGCCCAGG + Intergenic
904672895 1:32179607-32179629 GGCCTCGGAGGCGGGCGCCCCGG - Intergenic
904847331 1:33430453-33430475 CGGCTGGGGAGCGGGCGCCCCGG + Intronic
905789835 1:40784066-40784088 GCGCCGGGCTGGGGGCGCCGGGG - Exonic
905875329 1:41428433-41428455 GGGCCGGGATGTGGTGACCCAGG - Intergenic
908473882 1:64470413-64470435 AGGCCGGGGTGCGCGGGCCCCGG - Intergenic
912682594 1:111738790-111738812 GGAGCGGGACGCGGGCGCCTGGG - Intronic
913551307 1:119919479-119919501 GGGCCTGGAGGCTGGCACCCTGG + Exonic
914009748 1:143766458-143766480 GCGCCGGGCTGCGGGCGGGCAGG + Intergenic
915572342 1:156751429-156751451 TGGCGGGGCTCCGGGCGCCCCGG + Intronic
917853078 1:179081975-179081997 GGGCCGGGCTGAGTGCGCACTGG - Exonic
919451221 1:197775202-197775224 CGGCCGGGCTGCGGGCTTCCAGG - Exonic
921603698 1:217134081-217134103 CGGGCCAGATGCGGGCGCCCCGG + Intronic
922742614 1:228022715-228022737 GGCCCGGGATGCTGGCACACAGG - Exonic
922790722 1:228309433-228309455 TGGTCGGGATGGGGGCTCCCAGG + Intronic
922986342 1:229868921-229868943 GGGCTGGGATGAAGGGGCCCAGG + Intergenic
923171486 1:231421607-231421629 GGGCCGGGGCCCGGGAGCCCAGG - Exonic
923400713 1:233613833-233613855 GGGCTGGGCTGCCGGGGCCCGGG - Intergenic
923684141 1:236142399-236142421 GGGCCGGGGCGGGGGCGCGCGGG + Intergenic
923684151 1:236142419-236142441 GGGCCGGGGCGGGGGCGCGCGGG + Intergenic
1063097133 10:2918053-2918075 GGGCAGGTATGCGGACACCCTGG + Intergenic
1063664198 10:8051838-8051860 GAGCCGGGCTGCGGGGGTCCGGG - Intergenic
1064418108 10:15168275-15168297 GGGCGGGGAGGCTGGGGCCCGGG - Intronic
1065025233 10:21534542-21534564 GGGCCGGGCGGGGGGCGCCGGGG + Intronic
1065186225 10:23173383-23173405 GGGCGGGGAAGCGCGCGGCCAGG - Intergenic
1065215056 10:23440097-23440119 GGGCCGGGATCGGGGCTCCCCGG - Exonic
1066464238 10:35639521-35639543 GGGCGGGGGCGCGGGCGCCACGG - Exonic
1067113967 10:43420606-43420628 GGGGCGGGACGCGGACTCCCAGG + Intergenic
1070079173 10:73168415-73168437 GGGGCGGGCGGCGGGCGCTCTGG + Intronic
1070593893 10:77819334-77819356 GGCCCGAGATGCTGGCCCCCAGG - Exonic
1071695066 10:87862453-87862475 GGGCCAGGCTCCGCGCGCCCCGG - Exonic
1072151927 10:92690487-92690509 GGGACGGGAGGCGCGCGGCCGGG + Intronic
1072439135 10:95438481-95438503 GGGCCAGCATGCGGAAGCCCAGG - Intronic
1072731490 10:97849953-97849975 CGGCGGGGATGGGGGCGGCCGGG - Intergenic
1073207494 10:101776450-101776472 GCGCGGGGATGGGGGCGCCTAGG + Intronic
1073268333 10:102241547-102241569 GCGGCGGGCTGGGGGCGCCCTGG - Intergenic
1074829985 10:117241316-117241338 GGGCGGGGCTGCGGGGACCCCGG + Intronic
1074865683 10:117543242-117543264 GCGCCGAGGAGCGGGCGCCCTGG - Exonic
1076374211 10:129972760-129972782 GGGCCGGGTTGCCGGGGCCCCGG - Intergenic
1076417203 10:130300580-130300602 GGCCCGGCATGCGGGCCCCGGGG - Intergenic
1076554111 10:131311223-131311245 GGGCCGGGCAGGGCGCGCCCAGG + Intronic
1076657923 10:132036804-132036826 CGTCCGGGACGCGGGCGCCCTGG + Intergenic
1076679709 10:132165430-132165452 GGGTCGGGAGCCGGGCCCCCAGG - Intronic
1076736666 10:132462111-132462133 GGGGCGGGCTGGGGGCTCCCTGG + Intergenic
1076878953 10:133230783-133230805 GGACCGGGCGGCGGGCGCGCTGG - Exonic
1077016254 11:400284-400306 GGCCCGGGATGCGGGGTCCCTGG + Intronic
1077249900 11:1556477-1556499 GGGCCTGGCTGCGGGCGGCGGGG + Exonic
1077266949 11:1655557-1655579 GGTCCAGCATGCGGGAGCCCTGG - Intergenic
1077311082 11:1889394-1889416 GGTCCGGGAGGCGGGGGCCCGGG + Exonic
1078594456 11:12674584-12674606 GTGCCTGGACGCGGCCGCCCCGG - Exonic
1079402682 11:20118408-20118430 GGCCCGGGATGCCTGCACCCAGG - Exonic
1081699957 11:45146748-45146770 CGGCCGCGCTGCGGGCGCGCTGG - Intronic
1081705541 11:45180578-45180600 CGGCCGGGAGGGGGGCGCGCAGG - Intronic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081981671 11:47270410-47270432 GGACGGGGATGGGGGCGCCCCGG + Intronic
1082003712 11:47408553-47408575 GGGCCGGGGGCCGGGCGGCCGGG + Intronic
1083660075 11:64247792-64247814 GGGCGGGGGTGCAGGAGCCCCGG - Intergenic
1083753757 11:64778255-64778277 GGGCGGGGCTGCTGGCTCCCGGG - Exonic
1083896851 11:65624376-65624398 GGGCAGGGATGAGGTGGCCCAGG + Intronic
1083933284 11:65857591-65857613 TGGCAGGGATGCCTGCGCCCGGG - Intronic
1084538992 11:69775070-69775092 GGGCCGGGATGTCGGGGCCCGGG - Exonic
1084544076 11:69805221-69805243 GGGCTGGGATGCAGGGGGCCGGG + Intergenic
1085038026 11:73311153-73311175 GGGCCTGGATTCGAGGGCCCTGG + Exonic
1085396436 11:76209255-76209277 GGCCCGGGAGGCGGCCGCCTGGG + Intronic
1085784576 11:79438932-79438954 AGGCCGGGGTGGGGGCGCCCCGG + Intronic
1089519942 11:119056875-119056897 GGGCCGAGCTGCGTGCCCCCCGG + Intronic
1089910557 11:122095648-122095670 GGGCCGGGAAGGTGGAGCCCTGG + Intergenic
1090029733 11:123196169-123196191 GGGCCGGGTTCCCGGAGCCCGGG - Intergenic
1090042283 11:123301753-123301775 GGGCAGGGACGGAGGCGCCCAGG + Intergenic
1090238116 11:125164495-125164517 CGGCAGGGAGGCGGGCGGCCTGG - Intergenic
1090375186 11:126283230-126283252 GGGCCGGGACTCTGGGGCCCAGG - Intronic
1091295506 11:134471502-134471524 CGGACAGGAGGCGGGCGCCCCGG - Intergenic
1091427286 12:401934-401956 AGTACGGGATTCGGGCGCCCTGG + Intronic
1091769660 12:3142661-3142683 GGGCAGGGATGCGGGGCACCAGG - Intronic
1092120223 12:6038437-6038459 AGGCCGGGCTGGGGGCTCCCAGG + Intronic
1094124991 12:27014257-27014279 GGCGCCCGATGCGGGCGCCCCGG - Exonic
1095310574 12:40692777-40692799 GGTGCGGGATGCCGGAGCCCTGG + Intronic
1096262861 12:50103914-50103936 GGGTGGGGAGGCTGGCGCCCAGG - Exonic
1096309194 12:50505250-50505272 GGGCCGGGGAGAGGGCGCCCGGG + Intronic
1097237491 12:57550068-57550090 GCAGCGGGATGCGGGCGACCTGG - Exonic
1101365349 12:104064973-104064995 GGGCTGGGGTGGGGGCGTCCGGG - Intronic
1101606066 12:106248185-106248207 GGGCCGGGAAGCCGGCGCGGGGG + Intronic
1102197255 12:111034316-111034338 GGGCGGGCAGGCGGACGCCCTGG + Intronic
1103505326 12:121439196-121439218 GGGCCGGGAGGCAAGGGCCCTGG - Intronic
1103708784 12:122895794-122895816 GGGGCGGGGTGCGGGAGCCAGGG - Intronic
1103983990 12:124755129-124755151 GGGCTGGGCCTCGGGCGCCCTGG - Intergenic
1104013337 12:124947294-124947316 GGGCCTGGCTGGGGGCCCCCAGG - Exonic
1104624010 12:130338180-130338202 GGGCCGGGATGCGGGGGCGGCGG + Intronic
1104624244 12:130338846-130338868 GGGCCGGGGTGCGGGGGTGCAGG + Intronic
1104919550 12:132283462-132283484 GGGGCCGGATGTGGGCGCTCAGG - Intronic
1105009355 12:132745117-132745139 GGGCCGCGGTGCGGGCGCTGTGG - Intronic
1107276786 13:38687764-38687786 GAGACGGGCTGCGCGCGCCCAGG - Exonic
1108063264 13:46553369-46553391 GGGGCGGGGTGGGGGGGCCCGGG + Exonic
1112771576 13:102799597-102799619 AGGCCGGGCTGGCGGCGCCCAGG - Intronic
1113381687 13:109811208-109811230 GGGCCGGGATGGGAGTGCGCGGG - Intergenic
1113657685 13:112078518-112078540 GGGCTGGAAAGCGGGCTCCCTGG - Intergenic
1113713945 13:112489324-112489346 GTGGTGGGATGCGGGCACCCGGG - Intronic
1113743376 13:112725949-112725971 GGGGCGGGAAGCGGTGGCCCTGG + Intronic
1113775632 13:112943465-112943487 GGGCCGGGGCGCGGCGGCCCGGG + Intronic
1116628529 14:47298602-47298624 TGGCCGGGATGCCAGGGCCCAGG + Intronic
1117377460 14:55129338-55129360 GGGCAGGGGAGAGGGCGCCCGGG + Intronic
1117647235 14:57865497-57865519 GGGCCCGGCTGGGTGCGCCCAGG - Intronic
1119106755 14:71932328-71932350 GGGCCCAGGTGCCGGCGCCCAGG + Intergenic
1119562887 14:75605043-75605065 GGACCGGGCGGGGGGCGCCCAGG + Intronic
1120881120 14:89416421-89416443 GGGCCGGGATGAGGGGGGTCGGG + Intronic
1121803861 14:96797497-96797519 GGGCGCGGAGGCGGGCGGCCGGG + Intronic
1122582082 14:102777395-102777417 GGGCGGGGCGGCGGGCGCGCCGG + Intergenic
1122805541 14:104254724-104254746 GGGCTGGCTTGCGGGCCCCCTGG - Intergenic
1122902932 14:104789229-104789251 TGGCCGGGATGCTGGGACCCAGG - Intronic
1122910960 14:104827348-104827370 GGGCTGCGAGGAGGGCGCCCAGG + Intergenic
1122917514 14:104865752-104865774 GGGCGGGGACCCGGGTGCCCAGG - Intronic
1122917928 14:104867337-104867359 GGGCGGGGATGGGGGCTCACTGG - Intronic
1123040318 14:105487690-105487712 GGGCAGGGAGGCGGGCGCCCGGG - Intronic
1123930772 15:25170697-25170719 GGGCGGGGAGGGGGGTGCCCTGG + Intergenic
1125419195 15:39487317-39487339 AGGCCGGGATGCCGGCCCCTTGG - Intergenic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1127606463 15:60592317-60592339 GGGCGGGGAGGAGGGCGCGCAGG - Intronic
1128119202 15:65133441-65133463 GGGCCGGGAGGCGGTGGCCGCGG + Exonic
1128173134 15:65530505-65530527 GTGCCGGGTTGCAGGCGCTCAGG + Exonic
1128987151 15:72230292-72230314 CGGGCGGGATGCGGCGGCCCGGG - Intronic
1129672423 15:77614622-77614644 GGTCCCGGATGCGGGCGCGGCGG + Exonic
1129931127 15:79412030-79412052 GAGCTGTGATGCGGGCCCCCAGG - Intronic
1130370966 15:83284831-83284853 GGGGCGGGAGGCGGCCTCCCGGG - Intergenic
1131061831 15:89409298-89409320 GGGGCCGGATGCGGGATCCCTGG + Intergenic
1131510100 15:93045024-93045046 GGAGCGGGACGAGGGCGCCCAGG + Exonic
1132314564 15:100880261-100880283 TCGCAGGGATGCGGGCGGCCCGG - Intronic
1132320117 15:100919416-100919438 GGGGCCGGGTGCGGGCGCTCCGG - Exonic
1132478633 16:154556-154578 GGAGCGGGAGGAGGGCGCCCCGG + Intronic
1132589773 16:721539-721561 GGGCCGGGCTGCGGGCGGGGCGG + Intronic
1132799464 16:1744527-1744549 TGGCGGGGCTGCGGGCTCCCCGG + Intronic
1132877949 16:2148622-2148644 GGGGCGCGAGCCGGGCGCCCGGG + Exonic
1132933886 16:2471565-2471587 GGGCCGGGCTGGGGCCGCCCGGG + Exonic
1133038382 16:3046857-3046879 GGGCCTGGCTGGGGCCGCCCCGG - Exonic
1133232184 16:4372022-4372044 GGGCGGGGAAGGGGGCGCCACGG + Intronic
1136912981 16:34159506-34159528 GGTCCGGAAGGCGCGCGCCCGGG - Intergenic
1137785455 16:51134397-51134419 GGCCCGGAGTGCGGGAGCCCCGG + Intergenic
1138686802 16:58733630-58733652 AGGCCCGAATGCCGGCGCCCCGG + Intronic
1139544785 16:67645085-67645107 GGGCCGGGCCGGGGGCGGCCTGG + Exonic
1139557108 16:67719253-67719275 TGGCGGGGATGCGCGGGCCCGGG + Exonic
1140519216 16:75567033-75567055 AGACCGGGATGAGGCCGCCCAGG + Intronic
1141625961 16:85261160-85261182 GAGCTGGGATGCGGCAGCCCAGG - Intergenic
1142049999 16:87951771-87951793 GGGCCGGGCTGCGGCAGCCGCGG - Intronic
1142156687 16:88535554-88535576 TGGCAGGGGTGGGGGCGCCCTGG + Exonic
1142471139 17:164021-164043 GGACTGGGCTGCGGGCACCCAGG - Intronic
1143016472 17:3893351-3893373 AGGCCGGGATGGGGGCGCAAAGG - Intronic
1143104972 17:4524997-4525019 GGGCCGGGAGGCCGGGGCGCAGG + Intronic
1143390510 17:6556672-6556694 GGGCGGGGGTGCGGGCCCGCGGG - Intergenic
1144500892 17:15786323-15786345 GGGGAGGGACGGGGGCGCCCAGG + Intergenic
1144519746 17:15945681-15945703 GGGCCAGGCTGGGGGCGCGCGGG + Intronic
1145163054 17:20588985-20589007 GGGGAGGGACGGGGGCGCCCAGG + Intergenic
1145205918 17:20984797-20984819 TGGCCGGGCTGAGGGCGGCCGGG - Intergenic
1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG + Intronic
1146370981 17:32265712-32265734 GGGCCCGGGTGGCGGCGCCCGGG + Intergenic
1146703331 17:34980839-34980861 AGGCGGGGAGGCCGGCGCCCGGG + Intronic
1146937098 17:36818691-36818713 GGGCTGGGCTGGGGGAGCCCTGG + Intergenic
1147264221 17:39225353-39225375 CCGCCGGGAAGAGGGCGCCCGGG + Intronic
1148406806 17:47423462-47423484 GCGCCTGGCTGCGGGCGGCCGGG + Intronic
1148419296 17:47531787-47531809 GGGCCGCGCTGCGGGAGCTCTGG + Intronic
1148561034 17:48606224-48606246 CGGCCGGGATGCGGCCACACCGG + Intergenic
1148772546 17:50075751-50075773 GGGTCAGGATGAGGGCTCCCAGG + Intronic
1151203539 17:72487942-72487964 GGGCCGTGATGCTGGGCCCCAGG - Intergenic
1151221379 17:72615453-72615475 GGGCCGGGTTGCGGGGGCGGGGG + Intergenic
1151755801 17:76074722-76074744 GGGCGGGGATGGGGGTGCGCTGG - Intronic
1151938886 17:77280991-77281013 GGGCGGAGGTGCGGGCGCTCCGG - Intronic
1152107941 17:78341845-78341867 CGGCCGGGTGGCGGGCGCCAGGG + Intergenic
1152321301 17:79610073-79610095 GGGGCGGGCTGGGGGCGCTCCGG - Intergenic
1152544930 17:80995611-80995633 GGGCCGGGAGGAGGGCACCCCGG + Intronic
1152552104 17:81035046-81035068 GGGCGGTGATGCGGGCGCAACGG + Intergenic
1152573545 17:81130700-81130722 GGGCAGGGGTGCGGGCTCTCTGG - Intronic
1152617967 17:81346380-81346402 GGGAGGGGCTGCGGGCGGCCGGG + Intergenic
1152705815 17:81843095-81843117 GGGCTGGAATGCGGACGCCAAGG - Intergenic
1152812085 17:82386888-82386910 GGGCCTGGGTGCGGGGTCCCAGG + Intergenic
1152942104 17:83178182-83178204 GGGCCGGGACCCGGGGGCCCAGG - Intergenic
1153805362 18:8705493-8705515 GGGCCGGGGTGCGGGGGGCGGGG + Intergenic
1153805574 18:8706194-8706216 CGGCAGGGATCCGGGCGGCCGGG - Intronic
1154012678 18:10589211-10589233 GGGCCGGGAGGCGATGGCCCCGG + Intergenic
1155507937 18:26549547-26549569 GGGCAGGGAGGGCGGCGCCCTGG - Intronic
1156036063 18:32769778-32769800 GGGCCGGGATGAGGGCGAAGCGG + Exonic
1157622155 18:49022877-49022899 GGGAGGGGAGGCGGGAGCCCAGG - Intergenic
1158434697 18:57427863-57427885 GGGGCGGGCTGGGGACGCCCTGG + Intergenic
1160163326 18:76491549-76491571 GGGGCGGGGGGCGGGCGCCGGGG + Intronic
1160453401 18:78979966-78979988 GCGCCGGGCAGCGCGCGCCCCGG + Intergenic
1160527862 18:79547897-79547919 CAGCCGTGCTGCGGGCGCCCTGG + Intergenic
1160577449 18:79864443-79864465 GGGCCGGGCTGGAGGCGGCCGGG + Intronic
1160731164 19:642381-642403 GGGCCGGGCTGGGGGGTCCCTGG + Intronic
1160731222 19:642545-642567 GGGCCGGGCTGGGGGGTCCCTGG + Intronic
1160731237 19:642585-642607 GGGCCGGGCTGGGGGCTCCCTGG + Intronic
1160731280 19:642707-642729 GGGCCGGGCTGGGGGCTCCCTGG + Intronic
1161072810 19:2270895-2270917 GGGCGGGGGGGCGGGCGGCCGGG + Intronic
1161210411 19:3062566-3062588 GGGGGGGGACGCGCGCGCCCGGG + Intronic
1161219872 19:3113596-3113618 GGGCAGGGATGCGGTGGGCCCGG + Intronic
1161266418 19:3366700-3366722 GGGCTGGGATGCGGGGGGCGCGG - Intronic
1161311374 19:3595956-3595978 GGGGCTGGAGGCGGGGGCCCAGG - Intronic
1161364169 19:3868758-3868780 CGGGCGGGATGCGGGCTCCGGGG - Intronic
1161628558 19:5340167-5340189 TGGGGGGCATGCGGGCGCCCCGG - Intronic
1161660313 19:5541730-5541752 GGGCCAGGTGGCGGGCGTCCCGG - Intergenic
1161984411 19:7645756-7645778 GGGACGGGGTGAGGGCACCCTGG - Intronic
1162079452 19:8209570-8209592 GGGCCGGGCTGGGGCCGCCATGG - Intronic
1162127120 19:8505781-8505803 GGGCCTTGGTGCGCGCGCCCTGG - Intergenic
1162861172 19:13506504-13506526 GGGGCGGGGCGCGGGGGCCCGGG + Intronic
1163320616 19:16572428-16572450 GGGCGGGGGGGCAGGCGCCCCGG + Intronic
1163370380 19:16897861-16897883 GGCCGGGGGTGCGGGCGCGCGGG + Intronic
1163404208 19:17112446-17112468 GGGCCGGCTGGCGGGGGCCCTGG + Intronic
1163478243 19:17539480-17539502 GGGGCGGGATGCGGGCGTTCGGG + Intronic
1163720397 19:18895787-18895809 GGGCCGGGACGAGGGGACCCCGG - Intronic
1164595510 19:29528828-29528850 GGGGCGGGAAGCTGGCGCCACGG - Intronic
1164639004 19:29811637-29811659 GGGGCGGGCCGCGGGCGCCGGGG - Intergenic
1164693205 19:30226036-30226058 GGGCGGGGAGGCGGCGGCCCAGG - Intergenic
1165746636 19:38233577-38233599 GGGCCGGGATTGGGGGGCACAGG + Intergenic
1165751726 19:38264448-38264470 GGGCCGGGGAGCGGCCGCGCAGG + Exonic
1165792429 19:38500236-38500258 GGGCTGGGATGGGGGAGCACAGG + Intronic
1165843862 19:38805655-38805677 AGGCCGGGATGGGGAGGCCCTGG - Intronic
1165906949 19:39200055-39200077 GGGCCAGGATGGGGGGACCCAGG - Intronic
1165958089 19:39514761-39514783 GGGCAGGGATGAGGGAGCCCAGG - Intergenic
1166068997 19:40376942-40376964 GGACCGGGATGAGGGGGCACAGG + Intronic
1166069146 19:40377351-40377373 GGGCTGGGATGGGGGGGCACAGG + Intronic
1166190424 19:41173060-41173082 GGGCTGGGATGGGGGAGGCCAGG - Intergenic
1166218761 19:41352647-41352669 GAGCCGGGAGGGGGGCCCCCAGG - Intronic
1166664346 19:44669819-44669841 GGGCTGGGATGGAGGAGCCCAGG - Intronic
1166861951 19:45816136-45816158 GGGCCGGGGTGCTGGGGCCGGGG + Exonic
1167266532 19:48485586-48485608 GGGCTGGGGGGCGGGGGCCCGGG + Exonic
1167267531 19:48491112-48491134 GGGCCGGGCGTCGGGGGCCCGGG + Exonic
1167513920 19:49911775-49911797 GGGCTGGGATGCTGTGGCCCTGG + Intronic
1168404096 19:56101943-56101965 GGGCCGGGGTGTGGGCCCCCTGG + Intronic
925187708 2:1860486-1860508 GGGCTGGGATGCTGGGGCCTGGG + Intronic
926217044 2:10912198-10912220 GGGCTGGCATCCGGGCGCCCGGG - Exonic
926914346 2:17878514-17878536 GGGCCCGCAGCCGGGCGCCCCGG - Intronic
927606473 2:24491170-24491192 GGGCGGGCAGGCGGGCGGCCGGG + Intergenic
928096738 2:28409499-28409521 GGGCAGGGCTGCGGGTCCCCAGG - Intronic
931321462 2:61177656-61177678 GGGCCGGGCCGCGGGAGCCGGGG + Exonic
932028398 2:68158054-68158076 GGGCGGGGATGCGGGCCGCATGG + Exonic
933858459 2:86441536-86441558 GGCCCGGGAGACGGGCGCCCGGG + Intronic
933896019 2:86809814-86809836 GGGCGGGGGTGCGGGTGCCAAGG + Intergenic
934761183 2:96857973-96857995 GGGCCGGGATGGCGACGCCTCGG - Exonic
934983760 2:98869415-98869437 AGGCCGGGATGGGGGTGGCCTGG + Intronic
937408001 2:121648890-121648912 GTGCCGGGAGGCGGGCGGCCCGG - Intronic
938381060 2:130836923-130836945 CGGCCGGGCTCCGGGCGTCCCGG + Intronic
940774961 2:157875934-157875956 GGGCCGGGAGCCGGGGGCCGAGG + Intergenic
941463144 2:165794289-165794311 GGGGCGGGAGGCTGGCGCGCAGG - Exonic
942046122 2:172100457-172100479 GGGCCGGGAGGAGGGAACCCCGG + Exonic
942116844 2:172736138-172736160 CGGCCGGGCTGCGGGTGGCCGGG + Intronic
942461587 2:176172069-176172091 AGGCCCGGACGCGGGCGCCATGG - Exonic
942505502 2:176637794-176637816 GGGCCGGGAAGAGGGGTCCCCGG + Intergenic
942653831 2:178194715-178194737 GGGCCGCGATGCGGGCACCTTGG - Intronic
942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG + Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
943665094 2:190600909-190600931 GGGCAGGGATGCTGGCCGCCAGG - Intergenic
946235740 2:218323459-218323481 GGCTCGGGAGGCGGGCGCGCTGG + Intronic
947741734 2:232487853-232487875 GGGCCGGCAGGCGGGCGGCGCGG - Intergenic
947860641 2:233354890-233354912 GGGCCGGGCGGGGGGCGCGCAGG + Intronic
948143101 2:235688813-235688835 GGGGCGGGATGAGGGGACCCAGG - Intronic
948459092 2:238120576-238120598 GCGCCGGGCAGGGGGCGCCCAGG - Intronic
948823114 2:240560388-240560410 GGGCGGGGAGGACGGCGCCCGGG + Exonic
948832078 2:240603121-240603143 GGGACGGGAGGCGGGAGCACTGG - Intronic
1168892718 20:1305415-1305437 TGGCAGGGAAGCGGGGGCCCAGG - Exonic
1169367185 20:5001246-5001268 GGGTCGGGGTGGGGGCGCGCAGG + Intronic
1171484262 20:25476275-25476297 GGCCCGGGCCGAGGGCGCCCTGG - Exonic
1172421996 20:34825595-34825617 GGGTCGGGCTGCGGGCGGCCGGG - Intronic
1173182269 20:40814362-40814384 GGGCGGGGATGGGGGCGGCAGGG + Intergenic
1173279793 20:41618150-41618172 GGGCCGGCGGGCGGGCGGCCTGG - Intronic
1174246757 20:49187889-49187911 TGGAGGGGATGGGGGCGCCCGGG + Intronic
1175170558 20:57077337-57077359 TGGCTGGGATGAGGGAGCCCAGG + Intergenic
1175859401 20:62142588-62142610 GGGCCGGGCTGCAGCCGCCCGGG - Intronic
1176061867 20:63176012-63176034 GGGCCGGGAGCCGGCCTCCCTGG + Intergenic
1176097263 20:63349880-63349902 TGGCCAGGCTGCCGGCGCCCTGG - Exonic
1176549947 21:8216854-8216876 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
1176568873 21:8399888-8399910 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
1176576787 21:8444123-8444145 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
1178906410 21:36640793-36640815 CGGCCAGGATGCGGGATCCCAGG + Intergenic
1179411784 21:41168147-41168169 GGGCAGGGATGGGCGCGCACCGG - Exonic
1179891817 21:44339087-44339109 GGGCCTGGCCGCGGCCGCCCCGG - Intronic
1180188819 21:46153191-46153213 GGGCAGGGCTGGGAGCGCCCAGG - Intronic
1180696291 22:17753603-17753625 GGGCGTGGATGCAGACGCCCTGG + Intronic
1180713808 22:17858117-17858139 GGGAGGGGATGCGGGCCTCCAGG - Intronic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1180962047 22:19766536-19766558 GGGCCGGCCTCCGGGCGCGCCGG - Exonic
1181745452 22:24952691-24952713 GCGCGGGGCTGCGGGCTCCCAGG + Intergenic
1181934635 22:26429644-26429666 GGGCCGGGATGCGGGCGCCCGGG - Intronic
1183407861 22:37639382-37639404 GGGGCGGGTTGCGGGCGCAGGGG + Intronic
1183427086 22:37745968-37745990 GGCCCGGGCCGCGGGCGCGCTGG - Intronic
1183744553 22:39685340-39685362 GGGCCGGGAGGTGGGGGCCAGGG + Intronic
1183931312 22:41237664-41237686 GGAGCTGGAAGCGGGCGCCCTGG - Exonic
1184086607 22:42269848-42269870 GGGCCGGGATGTGGGCGGGAGGG - Intronic
1184552352 22:45211037-45211059 GGGCCAGCATGCAGGCACCCAGG + Intronic
1184642618 22:45880432-45880454 TGGCCGGGCTGAGGGCTCCCAGG + Intergenic
1184797083 22:46738613-46738635 GGGCCTGGATGGGGGCGCCACGG + Intergenic
1185344089 22:50303946-50303968 GGGCTGGGATCAGGGCGCCTGGG - Intronic
1185409649 22:50674923-50674945 GGGCTCGGGTGCCGGCGCCCGGG - Intergenic
1203254837 22_KI270733v1_random:133180-133202 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
1203262893 22_KI270733v1_random:178259-178281 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
949105441 3:196972-196994 GAGCCGGGACGGGGGCGCGCAGG - Exonic
949993740 3:9600672-9600694 GGGCCGGGGGGCGGGGGCGCTGG + Intergenic
950658858 3:14454110-14454132 TGGCCGGGGAGCGGGAGCCCTGG + Intronic
952878681 3:37969484-37969506 GAGCCCGGATGCCGGCGTCCAGG - Intronic
952929293 3:38347052-38347074 GGGCAGGGGCGCGGGGGCCCCGG - Intronic
953099212 3:39809352-39809374 GGGCAGGGCTGCGCGCGCCCGGG - Intronic
954110281 3:48429569-48429591 GGGCTGGAATGCGGGGTCCCGGG - Intronic
954304427 3:49717923-49717945 GGGCCTGGGTGGGGGAGCCCTGG + Exonic
954384516 3:50237182-50237204 GGGCTAGGAGGCGGGAGCCCTGG + Intronic
954414815 3:50388128-50388150 GGGCTGGGAGGCAGGCGCCAGGG - Intronic
954558914 3:51539218-51539240 GGCTCTGGATGCTGGCGCCCCGG + Intergenic
954615291 3:51966349-51966371 GGGCTGGGATGGGGGTGCCCTGG + Intronic
958798780 3:98733046-98733068 GGGCCGGGGTCCGGGCGGCCTGG + Intronic
961081665 3:124033432-124033454 GGGCCGGGGTGCGGGCTGCCTGG - Intergenic
961260100 3:125595347-125595369 GGGGCGGGACGCCGGCTCCCGGG + Intergenic
961609227 3:128123484-128123506 GGGGCGGGATGCGCGCGCCAGGG - Intronic
961743071 3:129046171-129046193 GGGCCGGGAGGCGCACGGCCGGG - Intergenic
962222392 3:133574290-133574312 GGGCCGGGAGGCCGGCACTCGGG + Intronic
963733294 3:148992168-148992190 GGGCCGGGTTGCGGGAAGCCGGG + Intronic
966712163 3:182981235-182981257 AGGCCGGGCTGCGGGAGTCCAGG + Intronic
967896001 3:194396838-194396860 GGGCGGGGAGGCGGGCCCCGGGG + Exonic
968092804 3:195909088-195909110 GGGCCGGGGTGCAGGAGCGCGGG - Intronic
968114967 3:196082212-196082234 GGGCGGGGATGCGCGCGCAGCGG + Intergenic
968228833 3:196992457-196992479 TGGGCGGGATGGGAGCGCCCTGG + Intronic
968585347 4:1413789-1413811 GGGCAGGGATGAGCGCGCTCAGG + Intergenic
968605623 4:1533922-1533944 GGGCCGGGCTGCGGGCTCCCGGG - Intergenic
968655107 4:1775057-1775079 GGGCCGGCCTGCTGGTGCCCAGG - Intergenic
968774965 4:2535368-2535390 GGGGCGGGTTGCGGGGACCCAGG + Intronic
968809225 4:2792664-2792686 GGGCAGGGGTGGGGCCGCCCAGG + Intergenic
968815184 4:2818259-2818281 CCGGCGGGAGGCGGGCGCCCGGG + Exonic
968816737 4:2825255-2825277 GGGCTGGGAGGCGGACACCCGGG - Intronic
968887009 4:3340478-3340500 AGGCCATGAGGCGGGCGCCCGGG + Intronic
969053049 4:4386399-4386421 GGGCTGGGGTGTGGGCGCCCAGG - Exonic
969297425 4:6278152-6278174 GAGGCGGGATGCTGGGGCCCTGG + Intronic
969300004 4:6292140-6292162 GGGCCAGGATGGGGTCGCACAGG - Intronic
969392812 4:6902256-6902278 GGGAGGGGCTGCGGGAGCCCAGG + Intergenic
969617467 4:8262068-8262090 GTGCCGGGAAGCGGACGCCTCGG + Intergenic
974573327 4:63684317-63684339 GGGCGTGGTGGCGGGCGCCCGGG + Intergenic
976282057 4:83335082-83335104 TGGCCGGGATCCAAGCGCCCGGG + Exonic
978384698 4:108167946-108167968 CCGCCGGGATTCGGGCGCCGCGG - Exonic
981423758 4:144580860-144580882 GGTCCGGGATGCGGGGGGCATGG - Intergenic
981580095 4:146242379-146242401 AGGCGGGGATCTGGGCGCCCAGG - Intergenic
982746019 4:159104105-159104127 GGGCCGGGAGGAGGCCGGCCAGG + Intergenic
984811323 4:183798170-183798192 CGGCAGGGACGCGGGCACCCAGG - Intergenic
984966383 4:185143600-185143622 GGGCGGGCGGGCGGGCGCCCGGG - Intronic
985669859 5:1201680-1201702 GGGACGGGATCCGGGCGTCTAGG - Exonic
985783867 5:1884105-1884127 GGGGCGGCAAGGGGGCGCCCGGG + Intronic
985784641 5:1887362-1887384 GAGCTGGGGTGAGGGCGCCCCGG + Intergenic
985895578 5:2748650-2748672 GGCCCGGGCTGCGGGCCACCGGG - Exonic
987536862 5:19200508-19200530 GGTCCTGGATGCGGGTGCACTGG - Intergenic
990581804 5:57173510-57173532 GCGCCGGGAAGCGGCCGCGCAGG - Intergenic
990910079 5:60843992-60844014 GGACCCGGGTGCGGGGGCCCCGG - Intronic
992487469 5:77210508-77210530 GGGCAGGCGGGCGGGCGCCCTGG + Intronic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
997984436 5:138491843-138491865 GGGCCGCCACGCGGGCCCCCCGG + Intergenic
998406751 5:141878510-141878532 GGGCGGGGAGGCGGGCGGGCCGG - Intronic
998698352 5:144667046-144667068 GGGCCAGGATCCGGGCACCCGGG - Intergenic
1001263886 5:170257556-170257578 GGGCTGGTATGAGGCCGCCCAGG - Intronic
1001386360 5:171342781-171342803 GGGTCTGAATGCAGGCGCCCAGG - Intergenic
1002079540 5:176729130-176729152 GGGCTGGGGTGCGGGAGGCCGGG - Intergenic
1002275765 5:178103601-178103623 AGGCTGGGTAGCGGGCGCCCTGG - Intergenic
1002639171 5:180622551-180622573 GGGCCTGGGTGCTGGCGCACTGG - Intronic
1003175574 6:3750881-3750903 GGGCCGGCGGGCGGGCGCACTGG - Intronic
1004262106 6:14117627-14117649 GGGCGGGGACGGGGGCGCCCCGG + Exonic
1008160392 6:48068873-48068895 GGGGCGGGCGGCGGGCGCCGCGG + Intergenic
1012062970 6:94511492-94511514 GGGCGGGGAAGCGGGGGCCGGGG - Intergenic
1012475745 6:99613632-99613654 GGCCGGGCGTGCGGGCGCCCCGG + Exonic
1013007388 6:106086420-106086442 GAGCTGGGACGCGGGCGCCCGGG + Exonic
1013793472 6:113859623-113859645 GGGCGGGAATGGCGGCGCCCCGG + Intronic
1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG + Intronic
1017719866 6:157236591-157236613 GGTGAGGGGTGCGGGCGCCCCGG - Intergenic
1018238442 6:161749098-161749120 GGGCCGGGAGGCGGGCAAGCAGG + Intronic
1019395721 7:816728-816750 GGGACGCGAGGCGGGGGCCCGGG + Intronic
1019501540 7:1367227-1367249 GGGCTGGGATGTGGGGGCCCCGG - Intergenic
1019530222 7:1499479-1499501 GGGCCGCGTTGCGGGCGACCTGG - Exonic
1019635452 7:2073131-2073153 GGGCCGGGCTTGGGGCGCCTCGG - Intronic
1021992535 7:26152212-26152234 GCGCCGGGCTGCGGGCGGCTGGG + Intergenic
1023067201 7:36389775-36389797 GGGGCGGGGAGAGGGCGCCCCGG + Intronic
1024579755 7:50792729-50792751 GGGCCGCGGCGCGCGCGCCCGGG - Intronic
1026023992 7:66731009-66731031 GGGCCAGGCTGCGGGCCTCCTGG + Intronic
1026874060 7:73869733-73869755 GGGATGGGATCCTGGCGCCCAGG + Intergenic
1027111329 7:75442307-75442329 GGGGCGGGCTGCGGCGGCCCGGG + Intronic
1027283570 7:76626866-76626888 GGGGCGGGCTGCGGCGGCCCGGG + Exonic
1027539640 7:79452516-79452538 GGGCTGGGCTGGGGGCGCCTGGG - Intronic
1029110547 7:98211356-98211378 GGGCCGGGGTCCGGGTGTCCCGG - Intergenic
1029849404 7:103446295-103446317 CGGCAGGGATGCCCGCGCCCCGG - Intergenic
1033299779 7:140176252-140176274 GGGCGGCGATGGGGTCGCCCCGG - Intronic
1033406371 7:141074019-141074041 GGGGCGGGAGGCGGCCGCGCTGG + Intergenic
1033683674 7:143620563-143620585 GGGCCGTGCTGCGGGCTCTCGGG - Intergenic
1033700938 7:143837075-143837097 GGGCCGTGCTGCGGGCTCTCGGG + Intergenic
1034254063 7:149714900-149714922 GGGCGGGGGTGGGCGCGCCCGGG - Intronic
1034830698 7:154305125-154305147 GGGCCGGGAGGCGGGCGAGGAGG + Exonic
1035114637 7:156514432-156514454 GGGCCAGGATGCAGAGGCCCCGG - Intergenic
1035169754 7:157010783-157010805 GGGCGGGGCGGCGGGCGGCCGGG - Intergenic
1036432242 8:8702085-8702107 GGGTCCGGGCGCGGGCGCCCAGG - Exonic
1036808980 8:11854203-11854225 AGCCCTGGATGCAGGCGCCCAGG - Intronic
1036910812 8:12755528-12755550 CGGCGGGGCTGCGCGCGCCCGGG + Intronic
1037946136 8:22990787-22990809 GGCCTGGGATGCGGGGGCCTGGG - Intronic
1039574263 8:38611054-38611076 GGGTAGGGGTGGGGGCGCCCTGG + Intergenic
1043472661 8:80578257-80578279 GCGCGGGGGTGCGGGCGGCCGGG - Intergenic
1044819279 8:96145000-96145022 GGGCCCGGGCGCGGGCGCCGAGG - Exonic
1048484079 8:134831759-134831781 GGGCCGGGAAGTGGGCGCTGCGG - Intergenic
1049378861 8:142302193-142302215 GGGCAGGGCTGAGGGCGCCATGG - Intronic
1049419584 8:142510862-142510884 CGGCGGGGACGCGGGCGCCCCGG - Intronic
1049643470 8:143725875-143725897 GGGCAGCGATGCGGGCACCCTGG + Exonic
1049691077 8:143959457-143959479 GGTCCGGGATGCAGAGGCCCAGG + Intronic
1049792495 8:144478373-144478395 CTGCCGGCACGCGGGCGCCCAGG + Intronic
1053129149 9:35605506-35605528 GAGCCGGAGTCCGGGCGCCCGGG + Exonic
1053230204 9:36401215-36401237 GGGCGGGGCTGCGCGCGGCCCGG + Intronic
1057192718 9:93096374-93096396 CGGCAGGGATGCGGGCGCCCTGG + Intronic
1057773021 9:97984029-97984051 AGGCCGGGCTCCGCGCGCCCCGG + Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060268350 9:122125260-122125282 GAGCCACGATGCGGGTGCCCAGG - Intergenic
1060539444 9:124419786-124419808 GGGCGGGGATGGGGGCAGCCGGG + Intergenic
1060549013 9:124476506-124476528 GGGCCGGGGTGGGGGCTTCCCGG + Intronic
1060770146 9:126326722-126326744 GGGCCGGGCTCCGGGCCTCCCGG - Intergenic
1061305898 9:129733117-129733139 AGGCCGGGCTCCGGGCGCTCTGG - Intergenic
1061828259 9:133275064-133275086 GGGCCGGGGTGGGGGCGCTCAGG - Intronic
1062358403 9:136175953-136175975 GGGCAGGAATGTGGGCTCCCTGG + Intergenic
1062431148 9:136527403-136527425 GGGCCGCGAGGTGGGCGCCAGGG + Intronic
1062600166 9:137315916-137315938 GGGACGGTGTGGGGGCGCCCCGG - Intronic
1062615674 9:137394705-137394727 GAGCGGGGATGCGGCCTCCCCGG + Intronic
1062725562 9:138071542-138071564 GGGGCAGGAGACGGGCGCCCTGG - Intronic
1203790954 EBV:151253-151275 GGGGCAGGCTGCGGCCGCCCAGG - Intergenic
1203471238 Un_GL000220v1:116325-116347 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
1203479059 Un_GL000220v1:160297-160319 GGGCCGCGAGGGGGGTGCCCCGG - Intergenic
1185471529 X:386716-386738 GGGGCGGGGCGCGGGCGTCCGGG - Intronic
1185505511 X:630294-630316 AGGGGGGGATCCGGGCGCCCCGG - Intronic
1185836193 X:3347196-3347218 GGGGAGGGAGGCGGGCGCCGGGG - Intergenic
1186350075 X:8731750-8731772 AGGCTGGGAGGCGCGCGCCCCGG + Intronic
1186669844 X:11757871-11757893 GGGCCGGAGAGCGGGCGCTCGGG + Intergenic
1186849831 X:13569648-13569670 GGGAGGGGCTGGGGGCGCCCTGG - Exonic
1187389067 X:18874000-18874022 GGGCCGGGGTGCGGGGGGCGTGG - Intergenic
1193360608 X:80574656-80574678 GAGCCGGGAGGCGGGCGGCGCGG + Intergenic
1193654926 X:84187708-84187730 GGGCCGGGAAGCGGGCTCCCGGG - Intronic
1197767508 X:130068750-130068772 GGGCCAGGACACGGACGCCCTGG + Intronic
1200056229 X:153462785-153462807 GGGCCAGGAGGCAGGCACCCAGG + Intronic
1200084737 X:153598680-153598702 GCGCAGAGCTGCGGGCGCCCGGG + Intronic
1200292538 X:154886533-154886555 GGGCCGGGAGCTGCGCGCCCAGG + Exonic
1200339382 X:155382273-155382295 GGGCCGGGAGCTGCGCGCCCAGG + Exonic
1200347088 X:155458420-155458442 GGGCCGGGAGCTGCGCGCCCAGG - Exonic
1201240505 Y:11953604-11953626 GGGGAGGGAGGCGTGCGCCCGGG + Intergenic