ID: 1181935034

View in Genome Browser
Species Human (GRCh38)
Location 22:26432219-26432241
Sequence AAAAGCGATCTGCCCAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181935030_1181935034 7 Left 1181935030 22:26432189-26432211 CCGTCTCAAAAGAAAAGAAACAG 0: 1
1: 24
2: 733
3: 13075
4: 114198
Right 1181935034 22:26432219-26432241 AAAAGCGATCTGCCCAAGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 90
1181935029_1181935034 29 Left 1181935029 22:26432167-26432189 CCTGGGCGATAAGAGTGAAACTC 0: 39
1: 1886
2: 17376
3: 28818
4: 32180
Right 1181935034 22:26432219-26432241 AAAAGCGATCTGCCCAAGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181935034 Original CRISPR AAAAGCGATCTGCCCAAGGT TGG Intronic
901039135 1:6353864-6353886 GAAAGCAAGCTGCCCAGGGTGGG + Intronic
902336062 1:15755703-15755725 AGAAGTGATTTGCCCAAGGCTGG + Intergenic
905780963 1:40708854-40708876 AGAAGCAATGTGCACAAGGTCGG - Intronic
906332955 1:44902880-44902902 AAAAGTAATCTGCCCAAAGCAGG - Intronic
906685881 1:47762924-47762946 TAAAGTGATCTGCTTAAGGTCGG - Exonic
920821600 1:209386907-209386929 GGAAGTGATTTGCCCAAGGTGGG - Intergenic
1063923726 10:10956954-10956976 AAAAGTGATTTGCTCAAAGTGGG + Intergenic
1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG + Intergenic
1070542804 10:77428920-77428942 CAAAGCGAGCTGCCCCAGCTTGG + Intronic
1076430762 10:130400407-130400429 TCAAGCAATCTGCCCAAGGTGGG + Intergenic
1083786833 11:64954486-64954508 AAAAGAGAGCTGCCCAAGGCTGG + Intronic
1084194887 11:67518904-67518926 AAAAGCCATCTCCCCAGGCTTGG + Intronic
1084269057 11:68019541-68019563 AGAAGGGAGCTCCCCAAGGTTGG - Intronic
1084650843 11:70488375-70488397 CGAAGCCATCTGCCCACGGTTGG + Intronic
1085124718 11:73991995-73992017 AAAAGCGCTCTGCCCAAAGAAGG - Intergenic
1085309696 11:75508889-75508911 CAAAGCCACCTGCCCAGGGTAGG - Intronic
1088426691 11:109712635-109712657 AAAAAAGAACTGCCCAAGGCTGG + Intergenic
1097599499 12:61673283-61673305 AAAAACGAATTGCCCAAGATTGG + Intergenic
1097818166 12:64098421-64098443 AAAAGCAAACTCCCCAAGGTGGG + Intronic
1099234664 12:80069252-80069274 ATAAGAAATCTGCCCAAGGTAGG - Intergenic
1100728254 12:97433663-97433685 AATTGTGATCTGCCCAAGGAAGG - Intergenic
1102512161 12:113422903-113422925 AAAAGTGACTTGGCCAAGGTTGG + Intronic
1105492165 13:20899434-20899456 AGAAGTGACTTGCCCAAGGTAGG - Intronic
1105547574 13:21362015-21362037 GAAAGTGCTCAGCCCAAGGTGGG - Intergenic
1106813475 13:33382386-33382408 ATCAGCGATCTGCCCAGTGTGGG - Intergenic
1108256361 13:48615327-48615349 AAAACCAATCTGGCCAAGGCTGG - Intergenic
1109551012 13:63900179-63900201 AGAACTGATATGCCCAAGGTTGG - Intergenic
1110572902 13:77026379-77026401 CAAAGCAAACTGCCCAGGGTGGG - Intronic
1114406502 14:22462034-22462056 GAAAGGGATCTGCTGAAGGTAGG - Intergenic
1116795404 14:49384669-49384691 AGAAGCAATCAGCCCAGGGTAGG - Intergenic
1117831294 14:59753761-59753783 ACAAGCCATTTGCCCCAGGTAGG + Intronic
1120474338 14:84968708-84968730 AAAAGCAATTTGACCAAGGAAGG - Intergenic
1121090213 14:91176077-91176099 ACAATCGATCTGCCCTAGGATGG + Intronic
1122089073 14:99326229-99326251 AAGAGGGCTCTGCCAAAGGTGGG - Intergenic
1126669148 15:51100672-51100694 ATCAGGGATCTCCCCAAGGTGGG + Intronic
1127203365 15:56683878-56683900 AAATGCCATCTGCCCGATGTTGG - Intronic
1127639515 15:60902825-60902847 AAAAGCGTTCTGCCCAGTGAAGG - Intronic
1131158101 15:90087357-90087379 AATAGCGACCTTCCCAGGGTAGG + Intronic
1139614671 16:68081762-68081784 CAAAGTGACCTGCCCAAGGATGG + Intergenic
1148625862 17:49068505-49068527 AAAAGCCATCTGAGCAAGGGGGG - Intergenic
1151312202 17:73300185-73300207 AAATGGGATCTGCCCCAGGGTGG - Intronic
1155509357 18:26561699-26561721 ATAAGGGATGTGCCCAAGGATGG + Intronic
1155568733 18:27166471-27166493 AACAGAGATCAACCCAAGGTTGG - Intronic
1158682403 18:59580642-59580664 TAAAGCGACTTGCCCAAAGTAGG + Intronic
1160181907 18:76644308-76644330 AAAAGAGGACTGCCCAGGGTTGG - Intergenic
1164502814 19:28833555-28833577 AATACCGAGCAGCCCAAGGTAGG - Intergenic
1166427278 19:42689943-42689965 AAAAGCTATCTGATCAGGGTGGG + Intronic
930709885 2:54540648-54540670 AGAAACTATCTCCCCAAGGTTGG + Intronic
933071230 2:77860435-77860457 ACAAGCATTCTGCCTAAGGTAGG + Intergenic
937957780 2:127431617-127431639 AAAAGAGATCTGCCCGAGCTGGG + Intergenic
938240898 2:129741673-129741695 GAAAGCAAGCTGCCCAAGGCAGG - Intergenic
946448456 2:219759759-219759781 AAAAGCAATCTGCTCAAGGTGGG - Intergenic
1170757131 20:19214093-19214115 AAAAGGGATCTCCCCCAGCTTGG + Intronic
1171776832 20:29376383-29376405 ACAAGCGATCTGCCCACTTTGGG + Intergenic
1176967348 21:15226253-15226275 AAAAGTGATCTGCCAGAGGAGGG - Intergenic
1179247431 21:39645837-39645859 CAAAGCGATCTGCCCCGGGTCGG - Intronic
1181935034 22:26432219-26432241 AAAAGCGATCTGCCCAAGGTTGG + Intronic
952606622 3:35154930-35154952 CAGTGCGATCAGCCCAAGGTGGG - Intergenic
955177587 3:56632074-56632096 AAAAACAAACTGCCCAGGGTTGG - Intronic
955528172 3:59841993-59842015 AAAAGAGTTCTGCACATGGTTGG - Intronic
956734392 3:72226699-72226721 GAAAGTGATCTGCCCAAGAAGGG - Intergenic
968137931 3:196232468-196232490 ACAAGCAATCTGCCCACCGTTGG - Exonic
968556275 4:1247952-1247974 AAAAGGGATCTGGCCCAGGCCGG + Intronic
975105520 4:70564371-70564393 AAGTGCGAGCTGCTCAAGGTCGG + Intergenic
981575146 4:146196531-146196553 TTAAGCAATGTGCCCAAGGTTGG - Intronic
989531268 5:42510796-42510818 CAAAGCTATCTGCTCAAGGCAGG - Intronic
993110702 5:83653988-83654010 AACACCTATCTGCCCAAGGCAGG - Intronic
995525405 5:113046833-113046855 TGAAGCCATCTGCCCAAGGCTGG - Intronic
996074201 5:119170389-119170411 AAAAGCTGGCTGCCCAATGTTGG + Exonic
998952977 5:147410898-147410920 AGAACAGATCTTCCCAAGGTAGG + Intronic
1002777048 6:337239-337261 TAAAATGACCTGCCCAAGGTAGG - Intronic
1003404100 6:5814667-5814689 GAAAGTGCTCAGCCCAAGGTGGG + Intergenic
1005991111 6:30902784-30902806 AAAATCCTTCTGGCCAAGGTTGG + Intergenic
1007750593 6:44068463-44068485 AAAAGGGATCAGGCCAGGGTGGG - Intergenic
1008080899 6:47193657-47193679 AAAAGGCACCTGCCCATGGTGGG - Intergenic
1012703659 6:102494995-102495017 AAGAGGGATCTGCTCAGGGTGGG + Intergenic
1016166966 6:140958023-140958045 AAAAGCATTGTGCTCAAGGTGGG + Intergenic
1020993278 7:15229413-15229435 AAAAGCTATCCTCACAAGGTGGG + Intronic
1021574032 7:22091258-22091280 AAAAGCAGGCTGCCCAAGCTAGG + Intergenic
1026258654 7:68735121-68735143 AAAAGTGATCTGTTCAATGTGGG + Intergenic
1030848140 7:114447750-114447772 AAAAGGAATCTACCCAAGATGGG - Intronic
1030872581 7:114775192-114775214 AAATGCAAACTGCCCAAGGCAGG - Intergenic
1040014266 8:42688562-42688584 AAAAGACATCTGGGCAAGGTAGG + Intergenic
1044807247 8:96021027-96021049 AAAATCCATTTTCCCAAGGTCGG - Intergenic
1048284147 8:133128635-133128657 GAAAGCTACCTGCCCAAGATGGG - Intronic
1048336455 8:133506337-133506359 CAAAGCGATCTGCCCAGCTTGGG + Intronic
1051761072 9:20465166-20465188 AAAAGCTATCTACACAAGGGAGG + Intronic
1053098895 9:35352679-35352701 GAAAGTGATGTGCCCAAGCTAGG + Intronic
1053334830 9:37258137-37258159 AAAAGCAAACTGCTCAAGGGGGG - Intronic
1054702668 9:68429302-68429324 AAAAGTGAGCTTCCCACGGTAGG - Intronic
1059484136 9:114613910-114613932 TAAAGTGACTTGCCCAAGGTTGG - Intronic
1059494629 9:114699456-114699478 AGAAGTGACTTGCCCAAGGTGGG + Intergenic
1060030936 9:120214203-120214225 AAACGTGATGTGCTCAAGGTAGG - Intergenic
1060365888 9:123013042-123013064 AGAACCCATCTGCCTAAGGTGGG - Intronic
1187573859 X:20533292-20533314 GAAAGTGATCTGCCCCAGCTGGG + Intergenic
1188299187 X:28486683-28486705 ATAAGTAATATGCCCAAGGTTGG + Intergenic
1189782537 X:44530053-44530075 ACAAGCAATCTGCCCCAAGTGGG + Intronic
1193576400 X:83202826-83202848 TCAAGCGATCTGCCCAAACTTGG + Intergenic
1200124406 X:153806465-153806487 ACAAGACATCTGCCCAAGATGGG + Intronic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic