ID: 1181937314

View in Genome Browser
Species Human (GRCh38)
Location 22:26448189-26448211
Sequence GGCAAATGGCCTCCCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181937314_1181937316 -3 Left 1181937314 22:26448189-26448211 CCTGTGCTGGGAGGCCATTTGCC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1181937316 22:26448209-26448231 GCCTTCTCAGAACACTCAACAGG 0: 1
1: 0
2: 1
3: 16
4: 140
1181937314_1181937319 16 Left 1181937314 22:26448189-26448211 CCTGTGCTGGGAGGCCATTTGCC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1181937319 22:26448228-26448250 CAGGACCCTCCATTTGCTGAGGG No data
1181937314_1181937323 27 Left 1181937314 22:26448189-26448211 CCTGTGCTGGGAGGCCATTTGCC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1181937323 22:26448239-26448261 ATTTGCTGAGGGCCCATGATAGG 0: 1
1: 0
2: 2
3: 16
4: 124
1181937314_1181937318 15 Left 1181937314 22:26448189-26448211 CCTGTGCTGGGAGGCCATTTGCC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1181937318 22:26448227-26448249 ACAGGACCCTCCATTTGCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181937314 Original CRISPR GGCAAATGGCCTCCCAGCAC AGG (reversed) Intronic
901051359 1:6427339-6427361 GGGAATTCTCCTCCCAGCACAGG + Intronic
901187697 1:7385805-7385827 CACATTTGGCCTCCCAGCACTGG + Intronic
901627535 1:10632388-10632410 GGCAAAAGGCCTCCGGGCCCAGG - Intergenic
902717732 1:18283836-18283858 GGCAAATGGCATCCCTTCTCTGG + Intronic
902991730 1:20192428-20192450 GGCACATGGTCTCTCAGCACAGG - Exonic
905146160 1:35888340-35888362 GGAACAAGGCCTCCCAGAACAGG - Intronic
911091713 1:94022504-94022526 GGCTAAGGGCCTCCCTGAACAGG - Intronic
917539192 1:175897263-175897285 GGGAAAGGGCCTCTGAGCACTGG - Intergenic
918154584 1:181832577-181832599 GGCACCAGGTCTCCCAGCACTGG + Intergenic
919516581 1:198532781-198532803 GGCAAATATCCTCCCACCTCAGG - Intronic
922798901 1:228355175-228355197 GGCACATGGCCTCACAGCTCCGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065826284 10:29574747-29574769 GTCATAGGGCCTCCCAGCCCTGG + Intronic
1065951088 10:30651871-30651893 GTCATAGGGCCTCCCAGCCCTGG - Intergenic
1068046129 10:51888644-51888666 GGCAAATGAACTCCAGGCACTGG + Intronic
1070714834 10:78711887-78711909 CACAAATTGCTTCCCAGCACAGG - Intergenic
1070853025 10:79583199-79583221 GGGAAAATGCCACCCAGCACAGG + Intergenic
1070888057 10:79922106-79922128 GGGAAAATGCCACCCAGCACAGG - Intergenic
1071942652 10:90606834-90606856 GGCAAATGGGCACTCAGCAGTGG + Intergenic
1073477830 10:103765894-103765916 GGCCCCTGGCCTCCCCGCACAGG - Intronic
1074360006 10:112818082-112818104 AGCAAATGGCCTCCCAGCCCAGG - Exonic
1079257704 11:18846872-18846894 GGCAAATGCCCCTCAAGCACTGG - Intergenic
1085246818 11:75108631-75108653 GGCCAAAGGCCTCACAGCCCAGG + Intronic
1088399452 11:109407264-109407286 GGCCACGGGCCTCCCATCACCGG - Intergenic
1088796407 11:113269817-113269839 GGCAAAAGGCTTTGCAGCACAGG - Intronic
1089023679 11:115244922-115244944 GGCAAAAGGCCGCCATGCACTGG - Intronic
1089348344 11:117806300-117806322 GGGAAAAGGCCTCCCTGCAGGGG + Intronic
1092056467 12:5512071-5512093 GGCAAAGGTGCTCCCCGCACTGG + Intronic
1092262426 12:6959797-6959819 GGCACATTCCCTCCCATCACTGG + Intronic
1094852427 12:34388254-34388276 GGCAGAAGTCCTCCCACCACGGG - Intergenic
1096175780 12:49517569-49517591 GGGAAATGTCCTGCCAGCCCTGG - Intronic
1097694301 12:62761986-62762008 GGCAGAGGGTCTCCCAGCACAGG + Intronic
1100935868 12:99665415-99665437 GGTAAATGGCCTCTAAGCACAGG - Intronic
1101046349 12:100810235-100810257 GGGAAATGGTGTCCAAGCACAGG + Intronic
1102688816 12:114744487-114744509 GGCAAATGCCCTCCCCTCCCTGG - Intergenic
1107886562 13:44878672-44878694 TGCAATTTGCCTCCCAGCCCAGG + Intergenic
1109221354 13:59643956-59643978 GGAAAATGCCCACCCAGCAGAGG + Intergenic
1110035178 13:70673384-70673406 GGGAAAGGATCTCCCAGCACTGG - Intergenic
1112781258 13:102903431-102903453 GGGAAATGGCTACCCGGCACAGG + Intergenic
1117844854 14:59900392-59900414 AGCAAATGGCTTTCCAGCTCAGG - Intergenic
1119147794 14:72332550-72332572 GGCAGATGGGTTTCCAGCACTGG - Intronic
1119788960 14:77332172-77332194 GCCAAATGGCCTCTCAGTGCTGG - Intergenic
1121327956 14:93032732-93032754 GGCACATGTCCACCCAGCTCTGG + Intronic
1122179151 14:99943148-99943170 GACAGATGGCCTCCCTGCCCTGG - Intergenic
1122255422 14:100472577-100472599 GGGAAATGGCCTGCCAACAAGGG - Intronic
1122363019 14:101178605-101178627 GGCAGTTGGTCTCCCTGCACAGG - Intergenic
1122460350 14:101889381-101889403 GGAAAATGTCCTCCCCGCAAAGG - Intronic
1122681548 14:103468227-103468249 GGCAAGAGGTCTCCTAGCACTGG + Intronic
1123035566 14:105470473-105470495 GGCAAAAGGCCCCGCAGCACAGG - Exonic
1125831334 15:42718924-42718946 TGCAGCTGGCCTCACAGCACAGG + Intronic
1129189506 15:73929101-73929123 GGCTGATGGCCGTCCAGCACTGG - Intronic
1129409490 15:75341264-75341286 GGCAGATGGGCTTCCAGGACTGG + Intronic
1132570170 16:641041-641063 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570194 16:641090-641112 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570298 16:641384-641406 AGCACAGGGCCCCCCAGCACAGG + Intronic
1134121116 16:11586056-11586078 GGCAAATACCCTCCCCGCTCTGG - Intronic
1135773514 16:25235773-25235795 GGCTAATTCCCTCCTAGCACTGG + Intergenic
1136063804 16:27745420-27745442 AGGAAATGGCCTCACAGCCCTGG + Intronic
1136394205 16:29984038-29984060 GGCACAGGGCTCCCCAGCACTGG - Intronic
1136497066 16:30651256-30651278 CGGAAATAGCCTCCCAGGACCGG + Exonic
1136544312 16:30947291-30947313 GGAACCTGGCCTCCCAGCAGGGG - Exonic
1138490048 16:57371537-57371559 GGGAGAGGGCTTCCCAGCACCGG - Intergenic
1138553213 16:57758391-57758413 GGCGCATGGCCTCCCGCCACGGG - Exonic
1143275407 17:5706186-5706208 CCCATATGGCCTCCCAGCACTGG - Intergenic
1144465423 17:15493247-15493269 CCCCAATGGACTCCCAGCACAGG - Intronic
1147244086 17:39109196-39109218 GGCCCCCGGCCTCCCAGCACAGG + Intronic
1148724342 17:49777735-49777757 GGCTAATGGCCTCCCTGCTGTGG + Intronic
1151826201 17:76525883-76525905 TGGAAATCGCCTCCCAGCAAGGG - Intergenic
1152063666 17:78097962-78097984 GCCACACGGCCTCCCAGCTCAGG - Intronic
1152318996 17:79597500-79597522 GGCAAAGTGCCCCCCAGCGCTGG - Intergenic
1154161953 18:11987148-11987170 GGCAAATGGGGTCCCACCGCAGG + Intronic
1158303302 18:56076834-56076856 GGCATGTTGCATCCCAGCACAGG - Intergenic
1158604494 18:58883429-58883451 GACAAATAGGCTCCCTGCACAGG - Intronic
1161211036 19:3065847-3065869 GGCAGGTGGCCTCCCAGGAGAGG - Intergenic
1161325412 19:3661311-3661333 GGCACATGGCCGCCAAGAACAGG + Intronic
1163439584 19:17314886-17314908 GGCAAAGGGGCCCACAGCACAGG + Intronic
1164813282 19:31175081-31175103 GACAAATGGCCTTCCAGGGCTGG - Intergenic
1165894210 19:39131723-39131745 AGCAGATGGCCTCCCAGCCTGGG - Intronic
1165970341 19:39623846-39623868 GGCAGCAGACCTCCCAGCACAGG - Intergenic
925542904 2:4985399-4985421 GGCAAATAGCCCCACAGCAGCGG + Intergenic
927869115 2:26612644-26612666 GGCAAATGGCCTCCTGGAAGAGG - Intronic
928132089 2:28659825-28659847 GGAACCTGGCCTCCAAGCACTGG + Intergenic
931867151 2:66425771-66425793 GATAAACAGCCTCCCAGCACTGG - Intergenic
936238550 2:110767464-110767486 GGCAAGTGGGCTCCCAGAGCAGG + Intronic
938100094 2:128492677-128492699 GGGAGAGGGCCTCCCAGAACTGG + Intergenic
942560528 2:177213393-177213415 CGCAAATGGCCTCGAAGCATGGG + Intronic
945223118 2:207504644-207504666 GGCAAATGCCCGTCCAGCTCTGG + Intergenic
946180117 2:217943904-217943926 GGCCAAGGGACTCCCAGGACAGG + Exonic
946613390 2:221482947-221482969 AGCAAATGGGCTCCAAGCCCAGG + Intronic
947445818 2:230161789-230161811 GGCGAAGTCCCTCCCAGCACAGG - Intergenic
948530221 2:238599431-238599453 GGGCAAAGCCCTCCCAGCACTGG - Intergenic
948711976 2:239830896-239830918 GGGACCTGGGCTCCCAGCACTGG + Intergenic
1168750090 20:276121-276143 GGCAAATGGCCCCCAACCAAAGG + Intronic
1168947195 20:1770888-1770910 GGCCTTTGTCCTCCCAGCACTGG - Intergenic
1171258562 20:23710802-23710824 AGCACATAGCCTCCCAGCACAGG + Intergenic
1171265886 20:23772264-23772286 AGCACATAGCCTCCCAGCGCAGG + Intergenic
1175173044 20:57093126-57093148 GGCACCTGGCCTCCCTGCCCAGG - Intergenic
1175797268 20:61779713-61779735 GGCACATGGCTGCCCTGCACGGG + Intronic
1176220729 20:63968319-63968341 GGCACACCCCCTCCCAGCACTGG - Intronic
1178534730 21:33402797-33402819 GGGGAATGGCCTCCGAGCAGGGG - Intergenic
1179490998 21:41741549-41741571 TGCACGTGGCCTGCCAGCACGGG - Exonic
1179725424 21:43339006-43339028 GGAAACTGGCCTCACTGCACAGG + Intergenic
1180255740 21:46626163-46626185 GGCAAAGGGCCTCCCAGGGATGG - Intergenic
1181937314 22:26448189-26448211 GGCAAATGGCCTCCCAGCACAGG - Intronic
1184549594 22:45197390-45197412 GGGAAATGGGCTCGCAGCAACGG + Intronic
1185414513 22:50702548-50702570 GGCAAAGGGCTTCCCAGGAGCGG - Intergenic
949420947 3:3865018-3865040 GGCAAAAGGCATCCCAGCAGAGG - Intronic
950073157 3:10168615-10168637 TGCAAATGGCCAACAAGCACAGG - Intronic
954466837 3:50660254-50660276 GGCCACTGGCCTCCCAATACTGG - Intergenic
955069179 3:55557905-55557927 GGCTCAAGGCCTCCCAGTACAGG + Intronic
958149357 3:89670574-89670596 TGCAGAAGGCCTCCCATCACAGG + Intergenic
961133268 3:124488315-124488337 GGTAGCTGTCCTCCCAGCACTGG + Exonic
961469839 3:127104797-127104819 CACAAATGGCAACCCAGCACCGG - Intergenic
963607417 3:147423101-147423123 AGCAAGTGGCCTCCCAGTCCTGG - Intronic
967247431 3:187502158-187502180 ACCAAATGGCATCCCATCACAGG - Intergenic
969708928 4:8831701-8831723 GGCAAATTTCCTCACATCACAGG + Intergenic
972009299 4:34156194-34156216 GGCAAAGGGCATCCCTTCACAGG + Intergenic
972852907 4:43072482-43072504 GACTAAAGGCCTCCTAGCACAGG + Intergenic
974607667 4:64173919-64173941 GGCTAATGGCAGCTCAGCACAGG + Intergenic
976995906 4:91433484-91433506 GGCAAATGCCCTCCCTACACAGG + Intronic
978200858 4:106022440-106022462 AGGAAGTGGCCTCCCAACACAGG - Intergenic
985014757 4:185622806-185622828 GCCAAATGGTCTCCCAGCTCGGG + Intronic
985605725 5:857220-857242 GGGAACTGGCTGCCCAGCACCGG + Intronic
987816123 5:22902283-22902305 TGCAATTGGCCTCCCTGCAGTGG + Intergenic
991915586 5:71601615-71601637 GGCAACTGAACACCCAGCACAGG - Intronic
993181567 5:84560581-84560603 GCCCAATGCCCTCCAAGCACTGG + Intergenic
995549055 5:113262666-113262688 TGCAAATGGCATCCAAACACAGG + Intronic
997907484 5:137833457-137833479 GGCAAATGGCCTCTCTTCTCTGG + Intergenic
998817207 5:146026672-146026694 GGCAAAGAGCTTCTCAGCACAGG + Intronic
998890605 5:146741698-146741720 AGAATCTGGCCTCCCAGCACAGG - Intronic
1001636134 5:173211586-173211608 GTGGAAGGGCCTCCCAGCACGGG + Intergenic
1003505526 6:6737241-6737263 GGCAGGTGGCCGCCCAGCCCAGG - Intergenic
1006294479 6:33163998-33164020 GGCACATGGCTGCCCAGCAGAGG - Intronic
1007901676 6:45419796-45419818 GCCTACTGGCCTCCCAGCCCGGG - Intronic
1010439418 6:75876044-75876066 TGCATATTTCCTCCCAGCACAGG + Intronic
1014777372 6:125526986-125527008 GGCAAATGGTCACCCAGAAATGG + Intergenic
1018576604 6:165266339-165266361 AGCAGATGGCCTCCAAGCATGGG + Intergenic
1019731598 7:2632221-2632243 TGCTAGTGGCCTCCCAGCTCAGG - Exonic
1023028150 7:36070648-36070670 GGCATATGGCCTCCCTTCGCAGG + Intergenic
1024453674 7:49579302-49579324 GGCACATGCCCTCAGAGCACTGG + Intergenic
1026895617 7:74008400-74008422 GCCCCATGGCCTCCCAGGACCGG + Intergenic
1026944020 7:74305076-74305098 GGCAATTGGCCTGCCTGCCCTGG - Intronic
1026953211 7:74361084-74361106 GGGAAATGGATTCCCAGGACAGG - Intronic
1032810601 7:135411827-135411849 AGCAAGTGGCCTCTCAGAACAGG - Intronic
1038003635 8:23411633-23411655 CCCAAATGGGCTCCAAGCACAGG - Intronic
1039979218 8:42392127-42392149 GGCAAGTGGCCTCCGGGCGCGGG + Intronic
1041489290 8:58413710-58413732 CCCAAAAGGCCTCCCAGCCCTGG + Intronic
1044613763 8:94119516-94119538 TGCAACTGGCCTCCCTGCAGCGG - Intergenic
1046100412 8:109607954-109607976 TGCAAACAGCCTCCCAGCACAGG + Intronic
1048889000 8:138931461-138931483 GGCCACGGGCCTCCCAGCATGGG + Intergenic
1049235894 8:141512142-141512164 GGCACATGGCCACCCAGGAGTGG + Intergenic
1049534269 8:143170895-143170917 GGCAAATTGCCCCCAAACACAGG - Intergenic
1053477120 9:38390628-38390650 GGCAGTGGGCCTCCCATCACTGG - Intergenic
1055903812 9:81270281-81270303 GGCAAATGGGCACTCAGCAGTGG + Intergenic
1056806748 9:89734945-89734967 TGCCAATGGCTTCCCAACACCGG - Intergenic
1056876883 9:90342135-90342157 GGCAATTGACCTCCAATCACTGG + Intergenic
1057146049 9:92760209-92760231 GGCCCAGGGGCTCCCAGCACTGG + Intronic
1060540781 9:124428838-124428860 GGAAGCTGGCCTCCCTGCACAGG + Intergenic
1061404482 9:130385803-130385825 GGAAAGTCGCCTCCCAGCCCTGG + Intronic
1062374748 9:136256848-136256870 GGCAAAGGGACTGTCAGCACTGG + Intergenic
1192012427 X:67289236-67289258 GACTAATGCCCTCCCAGCCCAGG - Intergenic
1192681702 X:73259687-73259709 GACTAAAGGCCTCCGAGCACAGG - Intergenic
1199448394 X:147953176-147953198 GGGAATTGGACTCCCAGCAATGG + Intergenic
1199980076 X:152916073-152916095 GGCAACTGACGTCCCAGCAGGGG + Intronic
1200089601 X:153628109-153628131 GGCAGCTGGGCTCCCAGCTCTGG - Intergenic
1200157357 X:153984345-153984367 GCCAAATGGCATCTCAGCATGGG + Intergenic