ID: 1181938117

View in Genome Browser
Species Human (GRCh38)
Location 22:26453391-26453413
Sequence CTCCAACAGAAATGCCTCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181938117_1181938120 -5 Left 1181938117 22:26453391-26453413 CCGTGGAGGCATTTCTGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 220
Right 1181938120 22:26453409-26453431 TGGAGGAAGAAAGAAGGCAACGG 0: 1
1: 0
2: 12
3: 170
4: 1554
1181938117_1181938121 9 Left 1181938117 22:26453391-26453413 CCGTGGAGGCATTTCTGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 220
Right 1181938121 22:26453423-26453445 AGGCAACGGTCCAATGCTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181938117 Original CRISPR CTCCAACAGAAATGCCTCCA CGG (reversed) Exonic
900730489 1:4255740-4255762 CTCCAACAGAAAAGTCCCCAGGG + Intergenic
900938907 1:5785021-5785043 ATCCCACTGAAATGCCTGCAGGG + Intergenic
901133982 1:6980982-6981004 CTGTAACAGAACTGACTCCAAGG - Intronic
904684992 1:32253359-32253381 CTCAAACAAAAATGCCTCCCGGG + Intronic
904869214 1:33606107-33606129 CTCCACAGGAGATGCCTCCATGG + Intronic
906299562 1:44672245-44672267 CTCCAAGGGAAACACCTCCACGG - Intronic
907740737 1:57163314-57163336 TTTCTACAGAAATGCCTTCATGG - Intronic
908026962 1:59962412-59962434 CTCCAATAGGGATGACTCCAGGG + Intergenic
908560855 1:65304758-65304780 CTCAAACTCAAATGCCTGCAAGG + Intronic
916841090 1:168601678-168601700 CTCCAACAAAAATACCTCTTGGG - Intergenic
916943335 1:169699247-169699269 CTTGTACAGAAATGACTCCAAGG + Intronic
918193177 1:182196047-182196069 CTCCAAAAGAAATGCCATCCTGG - Intergenic
919705128 1:200669289-200669311 TTCCAACAGAAATGCAACCGAGG + Intronic
920007520 1:202844357-202844379 CTGCCACAGAAAATCCTCCATGG + Intergenic
920035834 1:203064845-203064867 CTCCAGCACAAATGCCTGCTGGG - Intronic
920460373 1:206135056-206135078 ATCCATCAGATATGCCTACAGGG + Intergenic
920709671 1:208283152-208283174 CTCCAACTCTAATGCCTACAAGG + Intergenic
922003377 1:221503712-221503734 CTAAAACAAAAATGCCTGCATGG - Intergenic
922576637 1:226665252-226665274 CTCAAACTCAAATGCCACCAGGG - Intronic
923761323 1:236847767-236847789 AGCAAACAGAAATCCCTCCAGGG + Intronic
924290999 1:242536231-242536253 CACCACCAGAAATGCTTGCATGG - Intergenic
1063878643 10:10508226-10508248 CTCAAACAGATAAGCCTTCACGG + Intergenic
1067553537 10:47252376-47252398 CTTCAGCATGAATGCCTCCAAGG + Intergenic
1067728911 10:48794813-48794835 CTCCCTCAGAAAGGCCACCAGGG - Intronic
1068988107 10:63125305-63125327 CTCAAATGGCAATGCCTCCATGG + Intergenic
1069153192 10:64991890-64991912 CTCCCACTGAGAGGCCTCCAGGG - Intergenic
1071835973 10:89417222-89417244 CTCCAACAGAATGGCCTTCAAGG - Exonic
1072485450 10:95850138-95850160 ATCAAATAGAAAAGCCTCCAGGG - Intronic
1074176072 10:111004515-111004537 TCCCAACACAAATGCCTCAAAGG - Intronic
1075467827 10:122664768-122664790 CTGCACCAGCAATGCCTACAGGG - Intergenic
1075629435 10:123992078-123992100 CACCAACAGGAATGACGCCAAGG + Intergenic
1077734859 11:4780182-4780204 CCCCAACAGAAATGTGTTCATGG - Intronic
1078396031 11:10982959-10982981 CTCTGGCAGAAGTGCCTCCAAGG - Intergenic
1079797537 11:24824424-24824446 CCCTAACAGAAATACCTCCAAGG - Intronic
1080456227 11:32422042-32422064 CACCAACAGAAAGGCCTCTGTGG + Intronic
1083590373 11:63890153-63890175 CTCCAACAGAAATGCTTCTTGGG - Intronic
1084608716 11:70187298-70187320 ATCCACCAGAAATGTCTCCGTGG + Intronic
1088197792 11:107294590-107294612 CTCCAACAGAACTGCAGCCGAGG + Intergenic
1091657377 12:2355393-2355415 CACCAACCGAAATGAGTCCAGGG - Intronic
1091671537 12:2455673-2455695 CACCAACACAGATGCCTTCAAGG + Intronic
1093275248 12:17117251-17117273 CTCCAACAGACCTGCAGCCAAGG + Intergenic
1093439305 12:19174826-19174848 ATCCAACAGAGATGACTGCATGG - Intronic
1093761772 12:22918981-22919003 CACAAACACAAATGCCTACATGG + Intergenic
1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG + Intronic
1094310180 12:29071896-29071918 GTGCAACAGAAATCACTCCAAGG - Intergenic
1095739529 12:45592020-45592042 CTGAGACAAAAATGCCTCCATGG + Intergenic
1098379814 12:69855313-69855335 CTCCAACAGACTTGTGTCCAGGG - Exonic
1101540547 12:105660971-105660993 CTCCCACAGACCTGCCTGCAAGG + Intergenic
1101558166 12:105830452-105830474 CTACAACAGAAATGCATGGAGGG + Intergenic
1101909796 12:108852843-108852865 CCCCCACGGAAATGACTCCAAGG - Intronic
1102233333 12:111278490-111278512 CTGCCACAGAGATGCCCCCATGG + Intronic
1102396633 12:112591467-112591489 CTCCAACTCAAATGGCTACAGGG - Intronic
1104346926 12:128008625-128008647 CACAAACTCAAATGCCTCCAGGG + Intergenic
1106576731 13:30981678-30981700 TTCAAACTGAAATGCCTACAGGG + Intergenic
1110291141 13:73807858-73807880 GTAAAACAGAAATTCCTCCAGGG + Intronic
1110743906 13:79030614-79030636 CTCTAACAGACATGCTTTCAAGG + Intergenic
1112482848 13:99792756-99792778 CCCAAACAGAAATTCCTGCAAGG + Intronic
1112942342 13:104879081-104879103 CATCAACTGAAATGCCTCCAGGG - Intergenic
1112942349 13:104879129-104879151 CATCAACTGAAATGCCTCCAGGG - Intergenic
1114579433 14:23744152-23744174 CTCCAACAGAACTGCAGCCGAGG - Intergenic
1117819446 14:59632498-59632520 CTCCAACTGAAAAGCAGCCAGGG - Intronic
1120486140 14:85115285-85115307 TTCCCACAGAAGTGCATCCAAGG + Intergenic
1120610352 14:86634091-86634113 CTCAAGAAGAAAAGCCTCCATGG - Intergenic
1120680468 14:87475001-87475023 CTGAAACACAACTGCCTCCAAGG - Intergenic
1121573514 14:94965095-94965117 CACCAACAGAAGTGCTTGCAAGG + Intergenic
1124161143 15:27271316-27271338 TTCCACCAGAACTGCCTCCGCGG + Intronic
1125215980 15:37274962-37274984 CCCAAACACCAATGCCTCCAGGG - Intergenic
1128577849 15:68788509-68788531 GTCCAACAGAACTTCCTTCAAGG + Intronic
1130542370 15:84830220-84830242 CTCCAAGAGGAATATCTCCAAGG - Intronic
1133392004 16:5418316-5418338 CTCCCACCGAGATGCCCCCAAGG - Intergenic
1133575490 16:7085153-7085175 TACAAACATAAATGCCTCCAAGG + Intronic
1138194381 16:55041561-55041583 CTCAAACTGAAATTCCTCCAAGG - Intergenic
1140799646 16:78473947-78473969 TTCGAACAGAAGTTCCTCCAAGG - Intronic
1142305020 16:89280035-89280057 CTCCAGAAGAGATGCCTCCAGGG - Exonic
1142995544 17:3757810-3757832 CTCCAGGAGAAAGGCATCCAAGG - Exonic
1143887388 17:10075409-10075431 CTTTAACAGAAAAGCTTCCAGGG - Intronic
1144204558 17:12970640-12970662 CTCCAGCAGACATCCCTGCATGG - Intronic
1146018572 17:29253955-29253977 CTCCCCCAGACATGCCTCTATGG + Intronic
1146596308 17:34172188-34172210 TCCCATCAGACATGCCTCCAAGG + Intronic
1146628004 17:34448605-34448627 GTCCAGCAGAACTGCCTTCAGGG - Intergenic
1148960355 17:51387326-51387348 CTCCAAGAGAGATGACTCCAAGG - Intergenic
1150858646 17:68777733-68777755 CTCCCAAAGAAATGCCCCCAAGG - Intergenic
1151932633 17:77242165-77242187 CTTCAACAGAAATGGCTCAGGGG + Intergenic
1153046047 18:856677-856699 CTCCATCAGGTATGGCTCCAGGG - Intergenic
1156253327 18:35373157-35373179 GTCCCACAGAAAGGCCTCAAGGG + Intronic
1156580780 18:38372314-38372336 CGCAAACTGAAATGCCTACAGGG - Intergenic
1157768806 18:50326538-50326560 CTCCAACACAAACTCCCCCATGG + Intergenic
1158257509 18:55569854-55569876 CTTCAATAAAAATGCCTCAAAGG + Intronic
1159702296 18:71643653-71643675 ATCTAACAGAAATGCTTCCTGGG + Intergenic
1160077905 18:75695038-75695060 TTCAAACATAAATCCCTCCAGGG - Intergenic
1161758869 19:6155954-6155976 TTTCAACAGAAATGCCACAAAGG + Intronic
1161791652 19:6363567-6363589 CACAAACACAAATGCTTCCAGGG - Intronic
1162863900 19:13529158-13529180 CTCCAACAGAAATACAACAAGGG - Intronic
1164912594 19:32025081-32025103 CTCAAAGAGAGATGGCTCCAAGG - Intergenic
1167062350 19:47157549-47157571 CACCATCAGAACTGACTCCAGGG - Intronic
926174471 2:10577375-10577397 CTCCAACAGAGCTAACTCCAGGG + Intronic
926855342 2:17250608-17250630 CTGCAACAGAAAAGTCTTCAGGG + Intergenic
927144205 2:20150906-20150928 TTCCATCAGAAATGGCTACAAGG - Intergenic
927224553 2:20750441-20750463 GTCCATCAAAAGTGCCTCCACGG + Intronic
928879549 2:36082509-36082531 CTCCATGACAAATGACTCCAAGG - Intergenic
929084772 2:38157623-38157645 CTCCACCAGACATCCCTACAGGG + Intergenic
930057901 2:47265839-47265861 TTACAACAGATATGCCTCCAAGG - Intergenic
930879799 2:56258186-56258208 CTCCCACAGCCATGCTTCCATGG - Intronic
931264530 2:60648926-60648948 CTCCCACAGTAATGGCTTCATGG + Intergenic
932466095 2:71925412-71925434 CTCCACCAGACATACCCCCAGGG + Intergenic
933880512 2:86664566-86664588 CTCCAACAGAACTGCAGCTAAGG + Intronic
937427403 2:121811837-121811859 CCCTAACAAAGATGCCTCCAAGG - Intergenic
938804338 2:134792111-134792133 CTCCATAAGCAAAGCCTCCATGG + Intergenic
940073005 2:149710621-149710643 TTCCAACATAAATACCTCAATGG - Intergenic
941675490 2:168339492-168339514 CTCCAACAGCAAACCATCCAGGG - Intergenic
942122796 2:172794668-172794690 CACAAACACAAATGCCTGCAGGG - Intronic
944744778 2:202644433-202644455 CTCCAAAAGACATATCTCCAAGG - Intronic
946374949 2:219302380-219302402 CTTCAGCAGAACTGCCTCCAAGG - Exonic
947302924 2:228708394-228708416 CTCAAACAAAAATGGCTCAAGGG - Intergenic
948237392 2:236401049-236401071 CTCCAAGACAAATGCCTCTGTGG - Intronic
948470932 2:238178330-238178352 CACCACCAGAACTGGCTCCATGG + Intronic
1169538802 20:6577806-6577828 ATCCAACAGAAATGCATGCATGG + Intergenic
1171094281 20:22316573-22316595 CTGCCCCAGCAATGCCTCCAGGG - Intergenic
1171993456 20:31714378-31714400 CTACAACAGAAATGCTGCAAGGG + Intronic
1172938999 20:38641787-38641809 ACCCAACAGAAATGCCTTAAAGG + Exonic
1174985444 20:55446764-55446786 ACCCAACTGATATGCCTCCAGGG + Intergenic
1175906611 20:62382975-62382997 CTCCATCAGGAGAGCCTCCAGGG - Intergenic
1175913564 20:62415647-62415669 CTCCCACAGAAAAGCCAGCAGGG - Exonic
1176387801 21:6147819-6147841 CCCTCACAGACATGCCTCCAGGG - Intergenic
1177737935 21:25116328-25116350 CTCCCACTGAAAGGCCTTCAGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178491903 21:33057811-33057833 CTCCCACAGACATGCAGCCACGG + Intergenic
1179027001 21:37687112-37687134 CAGCCACTGAAATGCCTCCAAGG - Intronic
1179106400 21:38404493-38404515 CTCCAACAGAAACGCCAGCCGGG + Intronic
1179186331 21:39087723-39087745 CTCCAACAAAACTGACTTCATGG + Intergenic
1179279620 21:39923577-39923599 CTCAGACTGAAAAGCCTCCATGG + Intronic
1179392960 21:41010786-41010808 CTCAAACTCAAATGCCTGCAGGG + Intergenic
1179735671 21:43390429-43390451 CCCTCACAGACATGCCTCCAGGG + Intergenic
1180048362 21:45320072-45320094 CTCCCACAGCAGAGCCTCCAAGG - Intergenic
1181537787 22:23555706-23555728 TTCCCTCAGAAATGCCTTCACGG + Intergenic
1181724654 22:24803581-24803603 CTCCAAGATAAAGGACTCCATGG - Intergenic
1181938117 22:26453391-26453413 CTCCAACAGAAATGCCTCCACGG - Exonic
1183302325 22:37064413-37064435 CTCCATCACAACTGCCCCCAGGG + Intergenic
950414472 3:12860882-12860904 CACCACCAGATATGCCACCATGG + Intronic
950762124 3:15240500-15240522 TTCCAACGTAAATGACTCCAAGG - Exonic
952075476 3:29691580-29691602 GTCCCACAGAAATGCCCCAAAGG + Intronic
953143213 3:40248680-40248702 CTCCATCAAAACTGCTTCCAGGG + Intronic
953199617 3:40767292-40767314 TTCAAACAGAAATGCATCCCAGG - Intergenic
953929524 3:46999017-46999039 CTCCAACAGAAAGACAGCCAAGG - Exonic
955364508 3:58299653-58299675 CTCCTAAAAAAATGGCTCCAGGG - Intergenic
958166552 3:89884659-89884681 CTCCAACAGACCTGCCTCTGAGG - Intergenic
958697606 3:97547292-97547314 CTCCAACAGACCTGCATCTAAGG - Intronic
959368139 3:105489152-105489174 CTCCAACAGAAAACTCTTCAGGG - Intronic
959532784 3:107452348-107452370 CTCCTTCAGAAATGCTGCCATGG - Intergenic
960448654 3:117778880-117778902 CTCCAACAGACCTGCAGCCAAGG + Intergenic
960791473 3:121436299-121436321 CTCCACCAGATATGCCAACATGG + Intronic
963716283 3:148807926-148807948 CTCCCATAGGAATTCCTCCATGG - Intronic
966931370 3:184677932-184677954 CTGCACCAGAAATCCCTCCAGGG + Intronic
966941239 3:184748862-184748884 CTTCAACAGAAAGGAGTCCAGGG + Intergenic
967808483 3:193735615-193735637 CTTCAACTAAACTGCCTCCAAGG + Intergenic
969090083 4:4687286-4687308 CTCCTACAGGAAGGCCTCCTGGG + Intergenic
970160201 4:13180581-13180603 CTACAACAGATATGCCTGGATGG + Intergenic
970609956 4:17715870-17715892 CTCCCACAGAAATGACTTAACGG - Intronic
972260084 4:37398892-37398914 CTATATCAGAAATGCCTTCAAGG + Intronic
975736260 4:77384162-77384184 CACCAATAAAAATGCCTCCCAGG - Intronic
976663243 4:87562532-87562554 TTCAAACAGAAATGCTTCCATGG - Intergenic
977079198 4:92501508-92501530 CTCCAAGAGAAATGCTTACAAGG + Intronic
979734299 4:124063548-124063570 TTCCCAGAGAAATGCCTCCCAGG - Intergenic
980441387 4:132850349-132850371 ATCAAAGAGAAATGCCTACATGG - Intergenic
980845422 4:138318593-138318615 CTCCACCAGGACTACCTCCAAGG + Intergenic
986059527 5:4174955-4174977 CTTTAACAAAAATGCTTCCAAGG + Intergenic
988015388 5:25550911-25550933 CTCCAGTAGAAATGACTTCATGG - Intergenic
988899478 5:35717283-35717305 TCCCAACAGATATTCCTCCAAGG - Intronic
990925189 5:61013901-61013923 CTCCAATAGGAATTACTCCAAGG - Intronic
991318343 5:65338546-65338568 CACCAGCAGACATGCCCCCAGGG + Intronic
992998867 5:82359735-82359757 CTCAAACTGCAATGCCTTCAAGG - Intronic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
994468635 5:100172334-100172356 CTACTATAGAAATGTCTCCATGG - Intergenic
995957250 5:117792563-117792585 CTCCACCACAAATGCCTATATGG - Intergenic
996388070 5:122929735-122929757 CTCCAAGAAGAATGCCTTCATGG - Intronic
997742492 5:136269345-136269367 CTCCAAGAAAATTGCCTTCATGG + Intronic
998257217 5:140597387-140597409 CTCCCACAGAAAGGCCACCCAGG + Intergenic
999023466 5:148197419-148197441 CTCAAACTCAAATGCCTCCAAGG + Intergenic
999122546 5:149220346-149220368 CTACAGTGGAAATGCCTCCAAGG + Intronic
1001292966 5:170477943-170477965 CTCCAATAGAAGTGCCTCCAGGG + Intronic
1002216502 5:177638768-177638790 CTCCAACAGAACTGCAGCTAAGG - Intergenic
1003120206 6:3313091-3313113 CGTCAACACAAATGCCTGCAAGG - Intronic
1003672080 6:8169141-8169163 CGCCTACTAAAATGCCTCCAGGG + Intergenic
1005603752 6:27454475-27454497 CATCAACAGAAATGACACCAAGG + Intronic
1006025191 6:31142372-31142394 CTCCAAGAGAGATGGCTGCAGGG + Intergenic
1007160579 6:39788826-39788848 CTCCAACTGCAATGCTTCCCTGG - Intergenic
1007420854 6:41718775-41718797 CACCAACTCAAATGCCTGCAGGG + Intronic
1007645286 6:43375270-43375292 ATCCTACAGAAATGCATACAAGG + Intergenic
1008395858 6:51005742-51005764 CTCCTGAAGCAATGCCTCCAAGG + Intergenic
1008605291 6:53133833-53133855 CACCATCAAAAATGCCTCCTTGG - Intronic
1010475601 6:76283079-76283101 CTCCAACAGACCTGCCACAAAGG - Intergenic
1011337379 6:86276079-86276101 CTCCAACAGAGAGGCCATCATGG - Intergenic
1012300401 6:97580562-97580584 CTCAAACTCAAATGCCTCTAGGG - Intergenic
1012586062 6:100923891-100923913 ATGTAACAGAAATGCATCCAAGG - Intergenic
1012932562 6:105332085-105332107 GTCCAACAGAACTGCCTACAGGG + Intronic
1013456907 6:110337996-110338018 CCCCCACAGAAATGATTCCAAGG + Intronic
1014049185 6:116931958-116931980 CTCCAACGGAAATGTTTACAAGG + Exonic
1014433818 6:121399699-121399721 CTGCAAAAAAAATGACTCCAAGG + Intergenic
1014985849 6:128008073-128008095 CTCCAACATATATATCTCCAGGG + Intronic
1015184035 6:130393104-130393126 ATCCAACAGAGATGCCTGCATGG - Intronic
1016770581 6:147845865-147845887 CTCCAAGATAAATGCCTAAAAGG - Intergenic
1017309485 6:152959127-152959149 CTCCCAAAGACATCCCTCCAGGG + Intergenic
1017750310 6:157485326-157485348 CTCCAACAAAACTGCCTCCCAGG - Intronic
1018376509 6:163218442-163218464 CTTCAACAGAACTCCTTCCAAGG + Intronic
1018650581 6:165988561-165988583 CTCCAACAGAAATGTATGAATGG - Intergenic
1018996089 6:168711724-168711746 CTGGCATAGAAATGCCTCCAGGG - Intergenic
1019269729 7:140184-140206 CTCCTAGAGAAAGGCCTCCCAGG + Intergenic
1019535420 7:1526694-1526716 CTCCACCAGCAATGCGTCCAAGG + Intergenic
1023117079 7:36873005-36873027 CTCTAATAGAAAGGCTTCCAAGG + Intronic
1024804247 7:53118102-53118124 CTCCCAGAGAAATGCAGCCATGG + Intergenic
1024915292 7:54492309-54492331 CAGCAACAGAAATGGCTGCAGGG - Intergenic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1026900673 7:74035368-74035390 CTCCACCAGGAATGGCCCCAGGG - Exonic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1028255507 7:88591667-88591689 CTACAACTGAAATGACTTCAGGG - Intergenic
1029194208 7:98793268-98793290 CTGCAGCAGAAATGCCACCAGGG + Intergenic
1029804547 7:102982611-102982633 CAGCAAAAGAAATGCCTCAATGG - Intronic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1034293949 7:149955142-149955164 CTCCAACAGAAATGCATGCTAGG + Intergenic
1034697691 7:153068645-153068667 AGCAAACAGAAATGCCTTCATGG + Intergenic
1034812122 7:154141718-154141740 CTCCAACAGAAATGCATGCTAGG - Intronic
1036489195 8:9209216-9209238 CTGAAACAGACAGGCCTCCATGG + Intergenic
1037377151 8:18243254-18243276 CTTCAACGGAAAAGCTTCCAAGG + Intergenic
1040492081 8:47932864-47932886 ATCCAACAGAAATGCATCAGTGG + Intronic
1041035522 8:53785765-53785787 CTCCAACAGACCTGCAGCCAAGG - Intronic
1042221187 8:66476298-66476320 GTCAAACAGAAATACCTGCACGG - Intronic
1044212134 8:89562306-89562328 GTCTAACAGAAATGCCTCAAGGG - Intergenic
1045736915 8:105307049-105307071 CTGCAACAGGAATGTCTTCAAGG + Intronic
1046814723 8:118571463-118571485 CTCCAAGGAAAATGCCTCCAGGG + Intronic
1047131622 8:122026862-122026884 CTCCAACAGAGAATGCTCCAAGG + Intergenic
1047710504 8:127547157-127547179 CTCCAACAGAAATGTCACGTAGG - Intergenic
1048580765 8:135728464-135728486 CTCCACCATAACTGCCACCAAGG + Intergenic
1049018774 8:139939812-139939834 TGGCAACAAAAATGCCTCCAGGG + Intronic
1053286861 9:36855351-36855373 CTCAAATGGAAATGCCTGCAGGG - Intronic
1055637729 9:78295167-78295189 CACAAACTCAAATGCCTCCAGGG - Intergenic
1055921792 9:81468440-81468462 CTCCTGCAGAAATCCCTGCAGGG - Intergenic
1056316602 9:85396367-85396389 CACCACCTGAAATGCCTTCATGG + Intergenic
1057797616 9:98169887-98169909 CTCCAACAGAACCACCTCCAAGG + Intronic
1058501049 9:105617149-105617171 ATCCAACAGCAATGCCTATAAGG + Intronic
1058554572 9:106153173-106153195 CAGCAACAGAAATCCCTCCAAGG - Intergenic
1059356783 9:113706024-113706046 CTGCAACAGAAATGGGCCCAAGG - Intergenic
1061902059 9:133678044-133678066 ATCCCACAGAACTCCCTCCAGGG - Intronic
1188615141 X:32149148-32149170 GTCCAGCAGAAATGTCTCCAAGG + Intronic
1190457157 X:50637589-50637611 CTGCAACAGAAATCCCTTCTTGG + Intronic
1191038869 X:56057526-56057548 CTCCAACAGTGCTGCCCCCATGG - Intergenic
1191602044 X:63018786-63018808 CTCCAACAGAACTGCATCTGAGG + Intergenic
1193882127 X:86936346-86936368 CTCCCATAGAAGGGCCTCCACGG - Intergenic
1195905007 X:109835952-109835974 CTCAAACATAAAGGCCTTCAGGG - Intergenic
1198975123 X:142327637-142327659 CTCCAGCAGAATGGCCACCATGG - Intergenic
1199853808 X:151743628-151743650 CTCCAACATGAATGCCACCCGGG + Exonic
1201541904 Y:15114016-15114038 CTCCAACAGAAATGCAGCTGAGG + Intergenic