ID: 1181939687

View in Genome Browser
Species Human (GRCh38)
Location 22:26465517-26465539
Sequence AGGGATAATCTGGACATTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181939678_1181939687 23 Left 1181939678 22:26465471-26465493 CCGGGAACTCGTGGAGACTAATG 0: 1
1: 0
2: 0
3: 1
4: 67
Right 1181939687 22:26465517-26465539 AGGGATAATCTGGACATTCGGGG 0: 1
1: 0
2: 2
3: 4
4: 76
1181939682_1181939687 -4 Left 1181939682 22:26465498-26465520 CCTCTTTGGTCACAAAAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1181939687 22:26465517-26465539 AGGGATAATCTGGACATTCGGGG 0: 1
1: 0
2: 2
3: 4
4: 76
1181939677_1181939687 26 Left 1181939677 22:26465468-26465490 CCACCGGGAACTCGTGGAGACTA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1181939687 22:26465517-26465539 AGGGATAATCTGGACATTCGGGG 0: 1
1: 0
2: 2
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181939687 Original CRISPR AGGGATAATCTGGACATTCG GGG Exonic
906806830 1:48787295-48787317 AGGGGTCATCTGGACATCCCTGG - Intronic
910607642 1:89104510-89104532 AAGGAGAATCTGGACAGTCATGG - Intergenic
911117945 1:94265591-94265613 AGGGATGATCAGGGCATTCCAGG - Intronic
922342684 1:224670288-224670310 TGGGAAGATCTGGACACTCGGGG + Intronic
1073169575 10:101492770-101492792 TGCTATAATCTGGACACTCGTGG - Intronic
1079932246 11:26578604-26578626 AGGGATGATCTGGAAATTGTGGG + Intronic
1083503884 11:63137265-63137287 AGGGATAATCTTGAAGTTCTTGG + Intronic
1087250493 11:95893538-95893560 AGGGATTAGCAGGACAGTCGTGG - Intronic
1090652698 11:128821536-128821558 AGGGATATTATGGGCATTTGTGG + Intergenic
1090990747 11:131815143-131815165 AGGGACCATCTGGACTTTCCCGG + Intronic
1097690748 12:62732370-62732392 ATGCACAGTCTGGACATTCGGGG - Intronic
1099349709 12:81550240-81550262 AGGGAAAATCTGGGGATTAGAGG + Intronic
1100759142 12:97787430-97787452 AGGAATATTTTGGACATTCCTGG + Intergenic
1103234274 12:119359348-119359370 AGTGAAAATCTGTACATTCTTGG + Intronic
1104101584 12:125617716-125617738 AGGGATAAGCTGGAAAGTAGTGG - Intronic
1106975051 13:35201554-35201576 AGTGATAATCTGGAAATTAGGGG + Intronic
1113422283 13:110180078-110180100 AGGGAGGATTTGGACATTAGTGG + Intronic
1114743875 14:25125629-25125651 AGGCCTCATCTGGACATTTGAGG + Intergenic
1119428357 14:74550373-74550395 AGGGATGATCTGGGAATTCAGGG + Intronic
1131438070 15:92438771-92438793 AGGTACATTCTGGACATTGGAGG - Intronic
1137037953 16:35582648-35582670 AGGGGTTATCTGCACATTTGTGG + Intergenic
1139329279 16:66175041-66175063 AAGGATACACTGGACATTCAAGG - Intergenic
1146908023 17:36630341-36630363 AGGGAAAATGTGGACATCTGAGG - Intergenic
1148551188 17:48551593-48551615 CGGGGTAATCTGGACACTCGTGG + Intronic
1151435420 17:74092837-74092859 AAGGATGATGTGGACAGTCGAGG - Intergenic
1156154970 18:34290888-34290910 AGGAAGAATCTGGACATTAGAGG + Intergenic
1156686502 18:39654473-39654495 AAGGATAATGTGGACATTTCTGG - Intergenic
1164758433 19:30708422-30708444 AGGAATAATCAGGACTTTCATGG - Intronic
1164848594 19:31459430-31459452 AGGGTTTATCTGGAGATTCCTGG - Intergenic
925143323 2:1564748-1564770 AGGGATAAGCAGGGCATTCAGGG - Intergenic
925899364 2:8497443-8497465 AGGGATAAAATAGTCATTCGTGG - Intergenic
926550388 2:14294231-14294253 AGGGAGAAACTGGACATCTGTGG - Intergenic
931129751 2:59321950-59321972 GGGGCTTATCTTGACATTCGGGG + Intergenic
940434894 2:153639908-153639930 AGGGATGACCTGGAAATTCTCGG + Intergenic
940725267 2:157329559-157329581 AGGTATAAGCTGGACACACGGGG + Intergenic
1169632740 20:7651046-7651068 AAGGATAAGTTGGAGATTCGGGG + Intergenic
1171197714 20:23213999-23214021 AGGAATCATCTGGACTTTAGTGG - Intergenic
1177089091 21:16743642-16743664 AGGAACCATCTGGACATTCCAGG + Intergenic
1177709245 21:24750053-24750075 ACTAATGATCTGGACATTCGAGG - Intergenic
1178907690 21:36650130-36650152 AGGAATAATCTAGACATTCGTGG - Intergenic
1181939687 22:26465517-26465539 AGGGATAATCTGGACATTCGGGG + Exonic
1184580069 22:45410909-45410931 ATGGATAATCTGCACATTGAGGG + Intronic
949510633 3:4763941-4763963 TGGGACAATCTGGTCATTCAAGG - Intronic
955521529 3:59780027-59780049 AGGGGTAAAATGGACTTTCGTGG - Intronic
974249914 4:59372570-59372592 AGGGATAATCTCTGCATTCATGG - Intergenic
978711652 4:111789778-111789800 AGGCAGAATGTGGACATTAGAGG - Intergenic
980873344 4:138635361-138635383 AGGGAAAATCTGTACGTTGGGGG - Intergenic
982953084 4:161725689-161725711 AGGCATCATCTGGATATTCAAGG + Intronic
983228253 4:165105332-165105354 AGAGATTATCAGGACATACGGGG + Intronic
983560548 4:169097274-169097296 AGGGATAATCTGGGTATGTGGGG - Intronic
984150929 4:176129441-176129463 AGGAAAAATCTGGAAATTTGGGG + Intronic
990633095 5:57692172-57692194 AGGGTTAATCTAGACCATCGAGG + Intergenic
993701144 5:91120680-91120702 AGGGAGAGTCTGGACATTCGGGG + Intronic
997673893 5:135697988-135698010 AGTGACAATCTGGACAGTTGGGG - Intergenic
1003173347 6:3737312-3737334 TGGGAGCATCTGGACATTCATGG - Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1010188662 6:73171293-73171315 AGGCATAATCTGGACTGTCCAGG - Intronic
1012807209 6:103909192-103909214 AGAGATAATTTGTACATTCTAGG - Intergenic
1014671826 6:124313966-124313988 AGGGATTCTCTTGACATTCCCGG + Intronic
1015329934 6:131965246-131965268 GGGGATGCTCTGGACATTCTGGG + Intergenic
1021976201 7:26013184-26013206 AGGGAAAATCTGGTCACTGGAGG - Intergenic
1024169429 7:46768750-46768772 AGGGATACTCTGGGAATTCTTGG + Intergenic
1024442002 7:49430793-49430815 AGGGAGAATCTGGAAACTGGAGG - Intergenic
1026125970 7:67579790-67579812 AGGGATGAGCTGGAAATTGGTGG + Intergenic
1026411570 7:70128270-70128292 AGGTATAGTCTGGGCATTTGAGG + Intronic
1030267538 7:107635656-107635678 AGGGATAAGCTGGAGAATTGGGG + Intergenic
1037223319 8:16552943-16552965 CGGGGTAACCTGGACATTCTAGG + Intronic
1042822032 8:72939707-72939729 AGGCAAAATCTGGACCTTCCTGG - Intergenic
1043615229 8:82116647-82116669 AGGGAAAATCTGGAACTTCCTGG + Intergenic
1046407612 8:113794456-113794478 AAGGATAAACTGGACATTAAAGG - Intergenic
1048298705 8:133235652-133235674 AGGGAAAATCTGGCCGGTCGCGG + Intergenic
1049945070 9:586466-586488 AGAGAGCAGCTGGACATTCGGGG + Intronic
1057294846 9:93828824-93828846 AAGGATCATCAGGACATTGGGGG - Intergenic
1059165219 9:112070618-112070640 AGGGATATTCCTGACATCCGAGG - Intronic
1060043024 9:120317918-120317940 AGGAATAATCTGAACATTGGGGG - Intergenic
1061338897 9:129962817-129962839 AGGGAAACTCTGGACCTTAGTGG + Intronic
1187284716 X:17893917-17893939 AGGGAGAATCTGCATATACGTGG - Intergenic
1187336388 X:18385623-18385645 AGGGAGAATCTGGATAATCCAGG + Intergenic
1189454814 X:41176362-41176384 AGAGATAATTTGGACAGTCCAGG + Intronic
1190605372 X:52136612-52136634 AGAGATAATCTGAACATCCCTGG + Intergenic
1191616103 X:63171071-63171093 AAGGTTAATATTGACATTCGAGG - Intergenic
1191620194 X:63207852-63207874 AAGGTTAATATTGACATTCGAGG + Intergenic
1200472095 Y:3596746-3596768 AGGGGCACTCTGGTCATTCGGGG + Intergenic