ID: 1181944351

View in Genome Browser
Species Human (GRCh38)
Location 22:26504380-26504402
Sequence CAGTGGAACTAAATGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181944351_1181944358 4 Left 1181944351 22:26504380-26504402 CCCCCTTCCATTTAGTTCCACTG 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1181944358 22:26504407-26504429 CTTAAATAAGAGCTATCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
1181944351_1181944360 17 Left 1181944351 22:26504380-26504402 CCCCCTTCCATTTAGTTCCACTG 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1181944360 22:26504420-26504442 TATCCCTGGGCCAGATGTGGTGG 0: 1
1: 0
2: 9
3: 105
4: 783
1181944351_1181944357 3 Left 1181944351 22:26504380-26504402 CCCCCTTCCATTTAGTTCCACTG 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1181944357 22:26504406-26504428 TCTTAAATAAGAGCTATCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1181944351_1181944359 14 Left 1181944351 22:26504380-26504402 CCCCCTTCCATTTAGTTCCACTG 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1181944359 22:26504417-26504439 AGCTATCCCTGGGCCAGATGTGG 0: 1
1: 0
2: 1
3: 16
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181944351 Original CRISPR CAGTGGAACTAAATGGAAGG GGG (reversed) Intronic
900465900 1:2825300-2825322 CAGGGGACCTAAATTGAAGCAGG - Intergenic
900541592 1:3205699-3205721 CGGTGGAGGTAAAGGGAAGGTGG + Intronic
901548726 1:9979126-9979148 CAGTGAAACTAGCTGCAAGGTGG + Intronic
905521228 1:38602083-38602105 CAGTGGAATTACATGGCAGCAGG + Intergenic
905933891 1:41808376-41808398 TAGGGGAACTCAATAGAAGGAGG - Intronic
906066984 1:42988029-42988051 CAGTGAAACGGGATGGAAGGAGG - Intergenic
907928762 1:58979449-58979471 CAGTGGAATTAAGTGCAAGAGGG + Intergenic
908143170 1:61209161-61209183 CAGTGGTATTAAATGGAAATGGG + Intronic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
911881877 1:103250513-103250535 CAGGGGAGCTAAAAGGAATGTGG - Intergenic
912468545 1:109890830-109890852 CAGTGGGAATAAATAGAAAGAGG - Intergenic
915354545 1:155248188-155248210 CAGGGGAACTTTTTGGAAGGTGG + Exonic
918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG + Intergenic
921648219 1:217645162-217645184 CATTGCAATTAAAAGGAAGGAGG - Intronic
922201190 1:223402955-223402977 CAGGGGAAGAAAATGGAATGGGG - Intergenic
923946401 1:238892973-238892995 CAGTGGGACAAACTGGCAGGAGG - Intergenic
1066525892 10:36279241-36279263 CAGAGGAACAAAATGGTGGGGGG + Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1070819926 10:79348587-79348609 CCCTGGAACCAAATGGAAGCAGG - Intronic
1073788467 10:106915777-106915799 GAGTGCAACAAACTGGAAGGGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075688381 10:124379375-124379397 CTGTGGAACTGAATGGACTGGGG - Intergenic
1076178916 10:128390808-128390830 CCGTGGAACTGAATGGAAAACGG - Intergenic
1085473687 11:76774367-76774389 AAGAGGAAAAAAATGGAAGGTGG - Intergenic
1085925773 11:81018835-81018857 CTGTGGAAGCAAATGGAATGGGG - Intergenic
1087343120 11:96934471-96934493 CAAAGGAACTAGATGGAAGCAGG + Intergenic
1087540443 11:99510961-99510983 CAGTGGAACAAGATGTAAAGGGG + Intronic
1087661600 11:100995298-100995320 CAGGGCAACTAAATGTAATGTGG + Intergenic
1087884476 11:103462141-103462163 CAGTGGTAATAAATGAAAGGTGG - Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1090199865 11:124846331-124846353 CAGTGGCACTAATAGGGAGGGGG - Intergenic
1092696065 12:11172400-11172422 CGGGGGAAGTAAATGGAATGGGG + Intergenic
1093756406 12:22857921-22857943 CAGTTAAACTAAATGGAGTGGGG + Intergenic
1095782111 12:46071756-46071778 CAGTGGGACTTAGTGGGAGGAGG - Intergenic
1096535890 12:52274469-52274491 AAGTGGAACTTAAAGGAAAGTGG - Intronic
1096875304 12:54625374-54625396 AACTGGAACCAAATGGAGGGAGG - Intergenic
1098989119 12:77045401-77045423 GGGTGGAACTAAAAGGCAGGAGG + Intronic
1100992205 12:100263808-100263830 AAGTGGAAATAAAAAGAAGGAGG - Exonic
1102776560 12:115524814-115524836 CAGTGGGGCTAACTGGAAGGAGG - Intergenic
1106619116 13:31356734-31356756 CAATGGAACTGAAAGGGAGGGGG - Intergenic
1107909253 13:45089742-45089764 CAATGGAAATAAATTGAATGTGG + Intergenic
1108054799 13:46474883-46474905 AAGTGGAACTATTTGGGAGGAGG + Intergenic
1108711592 13:53038268-53038290 AAGTGGTTCTAAATGGAGGGAGG - Intronic
1110179916 13:72604337-72604359 CAGCAAAACTGAATGGAAGGTGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112126514 13:96474157-96474179 CAGAGGAAAAAAATTGAAGGAGG - Intronic
1112171317 13:96975706-96975728 CAGTTAAAATAAATGGAAAGGGG + Intergenic
1114262022 14:21043769-21043791 GAGAGGAAATAAATGGAAAGGGG + Exonic
1115774636 14:36702025-36702047 AAGTGGAACTAAATGGACATGGG - Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1119340331 14:73871677-73871699 CAGTTGAACTGAATGGAATTAGG + Intronic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1121488340 14:94338783-94338805 CAAATGAAGTAAATGGAAGGTGG - Intergenic
1124200950 15:27678100-27678122 CAGTGGAAGTTAGTGGAAGAAGG - Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124346552 15:28926402-28926424 TAGTTGTACTAAATGGGAGGAGG - Intronic
1124552009 15:30690252-30690274 CACTTGAACTAAAAGGAGGGGGG + Intronic
1126346894 15:47705174-47705196 CAATGGTACTAAATGGAGAGAGG + Intronic
1129697129 15:77747085-77747107 CAGTGGAGCTAAAGGCAGGGAGG - Intronic
1129931008 15:79411405-79411427 CAGAGGAGCTTATTGGAAGGAGG + Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1130379541 15:83359790-83359812 AAGTGGTACAAAATGAAAGGAGG + Intergenic
1131111925 15:89769956-89769978 CAGGGGAACCAAATGAAGGGTGG + Intronic
1131499686 15:92950007-92950029 CAGTGGAAAACAAAGGAAGGGGG + Intronic
1133893310 16:9902317-9902339 CATTGCAACTAGAAGGAAGGAGG - Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1150246905 17:63682881-63682903 CATTGGGACTAATTGGAAGAGGG + Intronic
1153312674 18:3692540-3692562 CAGTGTAAATAAATGGGAAGAGG - Intronic
1153936374 18:9928428-9928450 CAGTGGAAGTAACTGGGAGAGGG - Intronic
1156536753 18:37871827-37871849 CAGTGATGCTCAATGGAAGGAGG - Intergenic
1156542773 18:37931789-37931811 CAGTGGAACAATATGAAAGATGG + Intergenic
1158377472 18:56887215-56887237 AAGTTGAACTATATGGAAAGGGG + Intronic
1160438332 18:78868211-78868233 CAGTGGACCTAGTTGGAAGTGGG - Intergenic
1161584472 19:5097729-5097751 CAGAAGAACAAAAGGGAAGGTGG - Intronic
1162248544 19:9423534-9423556 CAGTGGATCTACATGAAAAGTGG + Intronic
1163262939 19:16202094-16202116 CTGTGGAACTGATTGGAGGGAGG - Intronic
1164891331 19:31826103-31826125 CCCTGGAAGTAATTGGAAGGAGG - Intergenic
1165113397 19:33514717-33514739 CCCTGGAACTAAATGGCTGGGGG + Intronic
1166304853 19:41931885-41931907 CACAGGAACAAAAGGGAAGGTGG + Intergenic
925957567 2:8982610-8982632 CACTGGAAGTAGATGGATGGAGG - Intronic
925962786 2:9034040-9034062 CAGAAAAACTGAATGGAAGGGGG - Intergenic
927308425 2:21600289-21600311 CAATGGACCTAAAGGCAAGGTGG + Intergenic
928069300 2:28198619-28198641 CACTGGAGCTAAAGGCAAGGGGG - Intronic
928758336 2:34552845-34552867 CAGTTGAACTAATTGGGAAGAGG - Intergenic
928924626 2:36565256-36565278 AAGGAGAACTAATTGGAAGGAGG - Intronic
931719820 2:65059015-65059037 CAGAGGAGCTAAATAGATGGGGG + Intronic
934611286 2:95738644-95738666 CAGAGGAACTAAATTGCAGGTGG - Intergenic
935417429 2:102833667-102833689 CATTGCAACTAAATGCATGGTGG - Intronic
936544612 2:113380186-113380208 CAGAGGAACTAAATGGCAGGTGG - Intergenic
941296244 2:163741787-163741809 GAGTGGAACTAATTGTAAAGTGG - Intergenic
944259675 2:197662924-197662946 CTGAGGAAATAAATGGAAGGGGG - Intronic
944943396 2:204654465-204654487 CTGGGGAAGTAAATGGAATGTGG + Intronic
945005856 2:205405185-205405207 CAGTGGTTCTCAATGGGAGGGGG + Intronic
949072591 2:242035007-242035029 CAGTGGAACCTTCTGGAAGGTGG - Intergenic
1169034057 20:2435328-2435350 CAGGGGGACTCAATGGAAGCAGG - Intergenic
1169578462 20:6992203-6992225 CAGTAGATCTAAATAGAAGTAGG + Intergenic
1173515377 20:43661977-43661999 ATGTGGATCTCAATGGAAGGAGG - Intergenic
1173920437 20:46740702-46740724 CGGTGGAACAAGATGGAAGGTGG + Intergenic
1174623308 20:51893598-51893620 CATTAGAACTAAATGTAATGTGG - Intergenic
1177047496 21:16188266-16188288 CAGTGAAATTGAAGGGAAGGGGG + Intergenic
1177322894 21:19545043-19545065 CAGTACAACTAAATGCAATGTGG - Intergenic
1177323162 21:19547754-19547776 CAGTACAACTAAATGCAATGTGG + Intergenic
1177578529 21:22989543-22989565 CAGAGGCTCAAAATGGAAGGAGG + Intergenic
1179540709 21:42081847-42081869 CATGCGGACTAAATGGAAGGTGG - Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179658774 21:42861704-42861726 CAGTGGAAGAAATTGGAGGGAGG - Intronic
1181017763 22:20080839-20080861 TGGCGGAAATAAATGGAAGGTGG + Intronic
1181942181 22:26486771-26486793 AAGTAGAATTAAATGAAAGGCGG + Intronic
1181944351 22:26504380-26504402 CAGTGGAACTAAATGGAAGGGGG - Intronic
1182555441 22:31126279-31126301 CTGGGGAACTAAATGGAGGCAGG - Intronic
1203307096 22_KI270736v1_random:116828-116850 CAGTGGAATGGAATGGAATGAGG + Intergenic
1203312387 22_KI270736v1_random:151860-151882 GAGTGGAATGAAATGGAATGGGG + Intergenic
1203313194 22_KI270736v1_random:157183-157205 CAGTGGAATGGAATGGAACGGGG + Intergenic
953280030 3:41546208-41546230 CAGTAGCACTAAAAAGAAGGTGG - Intronic
954230253 3:49211302-49211324 AATTAGAACTAAATGGAAGCCGG - Intronic
954896134 3:53976560-53976582 CAGGTGAGCTAAATGGAAGCGGG + Intergenic
954971080 3:54652232-54652254 CAGCGGAAAAAAAGGGAAGGAGG + Intronic
955399482 3:58581266-58581288 CAGAGGAACCCAAAGGAAGGGGG + Intronic
956403206 3:68901786-68901808 CAGTGGAACACACTGGAAGGAGG + Intronic
956496219 3:69829722-69829744 AAGTGGAACCAAATGACAGGTGG - Intronic
959612949 3:108315122-108315144 CTGTGGAATTAAATTCAAGGGGG + Intronic
960040402 3:113144521-113144543 CAGTGGAAATAAATGGTAGTGGG + Intergenic
963741896 3:149089169-149089191 AAGTGGCACTAAAAGGACGGTGG + Intergenic
964131663 3:153295402-153295424 CAGTGGCAATAAATGGCATGGGG - Intergenic
965913409 3:173811036-173811058 GTGTGAAACTAAATGGCAGGAGG - Intronic
967012531 3:185449999-185450021 AAGTGGAAGGAACTGGAAGGTGG - Exonic
968201131 3:196756399-196756421 CAGTGGAACGCACTGGAAAGGGG - Intronic
973113439 4:46424631-46424653 CTGTTGAACTAAATGGAATGAGG - Intronic
973334802 4:48945051-48945073 CAGTGGCAGGAAATGGGAGGTGG + Intergenic
975340254 4:73231914-73231936 CAGTGGAAGTTACTGGAGGGTGG + Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979803170 4:124937164-124937186 CAACTGAACTAAATTGAAGGAGG - Intergenic
980730413 4:136815969-136815991 CAGTGGACCTAACTAGAAAGCGG - Intergenic
981486152 4:145288691-145288713 CAGCGAAACCAAATGAAAGGTGG - Intergenic
981567003 4:146112511-146112533 TGGTGGAAATAAATGAAAGGAGG + Intergenic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
984046976 4:174813691-174813713 CTTTGGAACTAAATAGAAAGAGG - Intronic
986821319 5:11469881-11469903 CAGTGAGACTAAATGGAGGCAGG - Intronic
986971563 5:13343200-13343222 CAGTGGTCCTTAATGGATGGAGG - Intergenic
989312487 5:40036384-40036406 CAGGAGAATTCAATGGAAGGTGG - Intergenic
990915638 5:60901631-60901653 CTGTGAGACTAAATGGAAAGAGG - Intronic
991611698 5:68456218-68456240 CACTGGAACTAAATTGGATGAGG - Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
994284795 5:97951640-97951662 CACTGGGACTTATTGGAAGGTGG - Intergenic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
994900647 5:105764510-105764532 CAGTGGAATTATATGGGAGGTGG + Intergenic
999134947 5:149312269-149312291 CAGGGGAACTAACTGGCTGGGGG + Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1003311814 6:4975343-4975365 CAGTGGAACCACCTGGATGGCGG - Intergenic
1003355115 6:5361616-5361638 CAGTAGAAGTTAATGGAAGTTGG + Intronic
1004159839 6:13203815-13203837 GGCTGGAACTAAATGGGAGGTGG + Intronic
1006867812 6:37222992-37223014 CAGTGGACATAAATGGTAGCAGG + Intronic
1008405988 6:51119177-51119199 CAATGGAACCAAAGGGAAGTAGG - Intergenic
1008861563 6:56155075-56155097 CACTGGAGCTTATTGGAAGGTGG - Intronic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1013718390 6:112991549-112991571 CAGTTAAACTAAATTGTAGGAGG - Intergenic
1014230590 6:118897801-118897823 CAGAGGAATTAAATGAAAGCTGG + Intronic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022134285 7:27432534-27432556 CTGAGGAAATAAATGGAAGGAGG - Intergenic
1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG + Intergenic
1023382771 7:39624213-39624235 GAGTGGAAAGAAAGGGAAGGAGG - Intronic
1023489938 7:40728628-40728650 AATTGGAACTGAATGAAAGGAGG + Intronic
1026973616 7:74482656-74482678 GAGTGGTAGTAACTGGAAGGGGG - Intronic
1027224034 7:76232925-76232947 CAGTGGACCTGCATGGAGGGAGG + Intronic
1028209518 7:88056078-88056100 CAATGAAATTAAATGGAAGCAGG - Intronic
1029954692 7:104625533-104625555 CAGAGGAACAAAATTAAAGGAGG - Intronic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031958699 7:127969127-127969149 CAGTGGAAGTAAATAGTTGGTGG + Intronic
1032637586 7:133726784-133726806 AACTGGAACCAAATGGAAAGTGG - Intronic
1034825239 7:154256395-154256417 CTGTGGAACCAAATGGAAACTGG + Intronic
1038124196 8:24653120-24653142 CAGTGAAACGTAATGGCAGGTGG - Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1043170661 8:76961844-76961866 CATTGTAACTAAATAGATGGTGG + Intergenic
1043572816 8:81624452-81624474 CAGTGAAACTAAAAGCAAGAAGG + Intergenic
1044333498 8:90948282-90948304 CATAAGAATTAAATGGAAGGTGG - Intronic
1045151092 8:99409090-99409112 CAGAGTGGCTAAATGGAAGGTGG - Intronic
1046008502 8:108515922-108515944 CAGTGGAACTAGAAGAAAAGGGG - Intergenic
1046966076 8:120167208-120167230 CAGTGGAAAGAAAGGGGAGGAGG + Intronic
1048160844 8:132019781-132019803 CAGTGGAACAGAATAGAAAGTGG + Intergenic
1048723725 8:137358104-137358126 CAGTGGAAGTAAATAAAAGCCGG + Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049267468 8:141676512-141676534 GAGTGGATGTAAAAGGAAGGCGG - Intergenic
1050392942 9:5165939-5165961 CAGTGGAACAAACTGGAAGTTGG + Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1051558068 9:18407230-18407252 CATTTGAGCTAAATTGAAGGAGG + Intergenic
1051905295 9:22088031-22088053 CAGAAGAACTAAAAGAAAGGAGG + Intergenic
1052150761 9:25112710-25112732 CATTGGAAATAAATAGAAGTGGG - Intergenic
1055337987 9:75252116-75252138 CATTGGGAGTGAATGGAAGGAGG - Intergenic
1055969598 9:81898685-81898707 CAGTGGAAGTATATGGAGTGTGG + Intergenic
1056292715 9:85160179-85160201 CAGTTCAACTACATGGAAAGTGG - Intergenic
1056292855 9:85161150-85161172 CAGTTCAACTACATGGAAAGTGG - Intergenic
1056703907 9:88935243-88935265 CAGTGGAATTAGGAGGAAGGAGG - Intergenic
1057049465 9:91912077-91912099 CAGGTGAACTAAATGCAATGTGG + Intronic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1058505360 9:105660930-105660952 CAGTGGAACCATATGCATGGTGG - Intergenic
1187661311 X:21549725-21549747 CAGTGGAACAGAATAGAGGGAGG + Intronic
1189286094 X:39853568-39853590 AAGGGGAACAAAATGGAAAGGGG + Intergenic
1189518727 X:41743267-41743289 TAGTGAAACTCAATGGAAGAAGG - Intronic
1190236070 X:48616748-48616770 CAGTTGATGTAAAGGGAAGGAGG + Intergenic
1190337516 X:49271058-49271080 CAGTGGAACTCAATAAATGGAGG - Intronic
1190736995 X:53262303-53262325 CAGTGCCAATAAAGGGAAGGAGG - Intronic
1194525848 X:94976966-94976988 CATTGCAACTCAATTGAAGGAGG - Intergenic
1195779625 X:108447356-108447378 GAGTGGTACAAAATGGATGGGGG - Intronic
1196390276 X:115200288-115200310 CAGTAGAACTAAATGAAATAGGG + Intronic
1197609963 X:128627051-128627073 AAGTGGAACTAAAGAGAAGTAGG + Intergenic
1197727470 X:129785946-129785968 AGGAGGAAATAAATGGAAGGTGG + Intronic
1198514201 X:137388073-137388095 CAGTGTAGCTAAATAGAAGAAGG + Intergenic
1201123453 Y:10892193-10892215 GAGTGGAACGGAATGGAATGGGG - Intergenic
1202605845 Y:26639121-26639143 AAATGGAATCAAATGGAAGGTGG + Intergenic
1202605972 Y:26640028-26640050 GAATGGAATCAAATGGAAGGTGG + Intergenic
1202606068 Y:26640706-26640728 AAATGGAATCAAATGGAAGGCGG + Intergenic