ID: 1181950602

View in Genome Browser
Species Human (GRCh38)
Location 22:26550931-26550953
Sequence GAGTGGTTCAAGAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181950602 Original CRISPR GAGTGGTTCAAGAGGGAAAA AGG Intronic
900291660 1:1926295-1926317 GAGTGGTTCAGCAGGACAAAGGG + Exonic
901651523 1:10745900-10745922 GTGTGGATCAAGAGGGGAAAAGG + Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902336421 1:15757498-15757520 GAGAGGATCAAATGGGAAAAGGG + Intronic
902358880 1:15930743-15930765 GACTGATTCAGAAGGGAAAATGG + Exonic
903062671 1:20681160-20681182 AAGAGGTTAAAGAGGCAAAAAGG + Intronic
904879731 1:33686542-33686564 GTGTGGTCCAAGCTGGAAAATGG - Intronic
906271227 1:44480598-44480620 GAGTGTTTTAAAAGAGAAAATGG + Intronic
908122733 1:61001279-61001301 GAGTGGGTGAAGAAGGAGAAGGG - Intronic
909749893 1:79145943-79145965 GAATGGGACAAAAGGGAAAAAGG - Intergenic
911044771 1:93619342-93619364 GAGGTGTCCAAGAGGGAGAATGG - Intronic
912134246 1:106640004-106640026 GATTGTTTAAAGAGGGAAAAAGG + Intergenic
916275748 1:162991424-162991446 GAGAGGTTCAAGAAGGAGAGTGG + Intergenic
916508030 1:165445518-165445540 GTGGGGTTCAAGAGAGAACAGGG + Intergenic
919676522 1:200389131-200389153 GAATGATTCTAGAGGGAAATGGG + Intergenic
920805358 1:209228716-209228738 GAATGAAACAAGAGGGAAAATGG + Intergenic
921763367 1:218942002-218942024 GAGTGGTCAAATACGGAAAATGG - Intergenic
922553934 1:226518933-226518955 GAGTGGCTAAAGACAGAAAAAGG + Intergenic
923078537 1:230632087-230632109 GAATGGAGCAAGAGGGGAAATGG + Intergenic
1063089376 10:2848714-2848736 GAGGGGTTTAAAAGGGAAAGGGG - Intergenic
1064056788 10:12104711-12104733 AGATGGTTCAAGATGGAAAAAGG - Intronic
1064119065 10:12603674-12603696 GAATGGGTCAAGCGGGAAAGAGG - Intronic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1069055943 10:63844831-63844853 GAGAGGGTCAAGAGGCCAAATGG + Intergenic
1069389777 10:67921397-67921419 AAGTGGATGAACAGGGAAAATGG + Intergenic
1070244969 10:74722099-74722121 GAGTAGTTGTAGAGGGAAAGTGG - Intergenic
1071491921 10:86142050-86142072 GCATGGTTCAAGAGTGGAAATGG - Intronic
1072448765 10:95522027-95522049 GAGTGGTAGAAAAGTGAAAATGG + Intronic
1074016607 10:109541355-109541377 GAATAGATCAAGTGGGAAAAAGG - Intergenic
1075966167 10:126613646-126613668 CAGTGATTGAAGAGGGATAAAGG - Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1078349029 11:10577346-10577368 GAAGGAATCAAGAGGGAAAAGGG - Intronic
1079251942 11:18792969-18792991 GAGAGGTTAAAGAGCTAAAAAGG - Intergenic
1080076087 11:28151466-28151488 GGGAGGTTGAAGAGGTAAAATGG - Intronic
1080153949 11:29085945-29085967 GAGTGATACAACAGGGCAAATGG + Intergenic
1080352077 11:31396837-31396859 GAATGGTTGGATAGGGAAAAGGG - Intronic
1080559697 11:33451788-33451810 GACTTGTTCAAGGGGGAGAAAGG - Intergenic
1080630864 11:34074464-34074486 GAACAGTTCAAGAAGGAAAAAGG - Intronic
1081307390 11:41530233-41530255 GAGTGTTTCAAGAAGGAAGTAGG + Intergenic
1084096112 11:66912710-66912732 GAGTGGGCCAAGAGGGAATGGGG + Intronic
1085511258 11:77089263-77089285 GGGAGGTTCAGGAGGGAAATGGG - Intronic
1088482482 11:110307915-110307937 GACGGGTGGAAGAGGGAAAAGGG - Intergenic
1089115815 11:116094198-116094220 GATTTGTTGAAGAGAGAAAATGG - Intergenic
1089464133 11:118673152-118673174 GAGTGGTTCAATAGAGAACTGGG - Intronic
1090314672 11:125775109-125775131 CAGTGGATTAAGAGGAAAAAAGG - Intergenic
1090775725 11:129963637-129963659 AAATGGTTCAAGTGAGAAAAGGG - Intronic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1093567087 12:20620120-20620142 GAGAGGTTCCAGAGCTAAAATGG - Intronic
1096097581 12:48946487-48946509 GAGTGGCTCAAGATGAAAAATGG + Intronic
1098099377 12:66997690-66997712 GAATTGGTCAAGACGGAAAAAGG + Intergenic
1098661619 12:73101440-73101462 GAGAGGTCCCAAAGGGAAAAGGG - Intergenic
1098771305 12:74557065-74557087 GAGTGGTTAAAGTGGGTTAATGG + Intergenic
1100053135 12:90475427-90475449 CAGTAGTTCAAGAAGGAAATAGG - Intergenic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101341631 12:103847306-103847328 GAATGGGTCACCAGGGAAAAGGG - Intergenic
1101746741 12:107547414-107547436 AGGAGATTCAAGAGGGAAAATGG - Intronic
1102394192 12:112574020-112574042 GGGTGGTGGAAGAGGGAAAGGGG + Intronic
1103367819 12:120395795-120395817 GAGTGGTTGAAAAGGCAAAATGG - Intergenic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1104579768 12:130002676-130002698 GAATGGGTCTAGAGGGATAAAGG - Intergenic
1106368357 13:29106146-29106168 GAGTAGTTCTAGAGGGACATCGG - Intronic
1106870762 13:34017228-34017250 ATATGGTTCCAGAGGGAAAACGG - Intergenic
1107158128 13:37193673-37193695 GAGGGGTCCAAGATGGAAAAGGG + Intergenic
1107183460 13:37489286-37489308 GAATTGTACAAGAAGGAAAAAGG + Intergenic
1107415191 13:40193477-40193499 GAATGCTTCAAGCTGGAAAACGG + Intergenic
1107588458 13:41878657-41878679 GAGTGTTTTAAAAAGGAAAAAGG - Intronic
1108582145 13:51836892-51836914 GAGTGATTCAAGAGGTAAACGGG + Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110287330 13:73765178-73765200 GAGTGGTTAAGAAGGAAAAAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112118139 13:96379914-96379936 AAGTGAATCAAGAGGAAAAAAGG + Intronic
1112867376 13:103922123-103922145 GAGACGTTCAAGCAGGAAAATGG + Intergenic
1113701242 13:112390172-112390194 CAGTGGTGCAAGAGGGCTAACGG + Intronic
1113937540 13:114002313-114002335 GAGCTGTTCAAGAGAGAAAAGGG + Intronic
1113980944 13:114275190-114275212 GATTGGTTCATGAGGTATAAGGG - Intergenic
1116663882 14:47749697-47749719 GAGTGCTTCAAGATGTAAAAGGG + Intergenic
1117351023 14:54882155-54882177 CAGTGGTTCAAGATGTAGAATGG + Intronic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1120764182 14:88313466-88313488 AAGTGATTCAAGAGAGAACAAGG - Intronic
1121367457 14:93326937-93326959 GACTGGGTTAACAGGGAAAATGG + Intronic
1121431074 14:93888846-93888868 GGGTGGGTCTAGGGGGAAAATGG + Intergenic
1123874488 15:24609892-24609914 GTTTGTCTCAAGAGGGAAAAGGG + Intergenic
1124456724 15:29849959-29849981 GAGTGATCCAAGAGAGAACAAGG - Intronic
1124928709 15:34098070-34098092 GAGTGGATCTAGAGGGCAAATGG - Intronic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1126493952 15:49269791-49269813 GAGTGGTCCAAGAATGAAAAGGG - Intronic
1129235638 15:74222237-74222259 TAGCTGTTCAAGAGGGAAACTGG + Intergenic
1130333298 15:82938015-82938037 GGGTAGATCAAGAAGGAAAATGG - Intronic
1131258256 15:90875557-90875579 GAGAGGAACAAGAGGGGAAAAGG - Intronic
1131336146 15:91551306-91551328 GAGTAGATCTAGAGGGACAAAGG - Intergenic
1131670128 15:94610909-94610931 GAGTGGTTTAATAGGGGGAATGG + Intergenic
1132032661 15:98451192-98451214 GTGTGCTTCATGAGGGAGAAGGG + Intronic
1132269252 15:100508808-100508830 GAGTAGCTGAAGAGAGAAAAAGG - Intronic
1136555203 16:31003489-31003511 GAGTGGTTGAAGGGAGAGAAAGG - Intronic
1137613170 16:49832561-49832583 GAGTGGGGCAAGAGGGGGAAGGG + Intronic
1138624920 16:58243821-58243843 AAGGGGTTTAAGAAGGAAAAAGG + Intronic
1139656249 16:68388734-68388756 GAGGGGTTCCTGAGGGGAAATGG + Intronic
1143046940 17:4088942-4088964 TATTGATTAAAGAGGGAAAAAGG + Intronic
1144105837 17:11984341-11984363 GAGTGGTTCAAGGGACAAAGAGG + Intronic
1144182161 17:12762570-12762592 GAAGGGTTCAAGTGGGGAAAAGG + Intronic
1145413913 17:22696754-22696776 GAGTGGTTAGAGAGGGGAACAGG - Intergenic
1145414246 17:22702003-22702025 GAGTGGTTAGAGAGGGGAACAGG + Intergenic
1148541582 17:48484934-48484956 CAGTTGTTCAAGATGAAAAAAGG - Intergenic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1156621221 18:38854247-38854269 GAATGGTTGAAGAGAGAAAGCGG + Intergenic
1159188739 18:65014470-65014492 GAGTGGTACAAAAGAAAAAATGG + Intergenic
1160071523 18:75633046-75633068 GAGTGGTTTAAGTGGGACATGGG + Intergenic
1160739359 19:678898-678920 GAGTGGATCAGGAGAGAACATGG + Intronic
1162791311 19:13064436-13064458 GAGAGGGCCAACAGGGAAAAGGG - Intronic
1163501671 19:17680036-17680058 GAGGGGTCTCAGAGGGAAAAGGG + Intronic
1165417360 19:35702974-35702996 GAGTGGGACAAGAGAGAAAAGGG + Intergenic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
926223777 2:10953316-10953338 GAGTGGGTAAAGAGGGGATAGGG + Intergenic
926789967 2:16560597-16560619 GACTGTTTCAAGAGTGAAAATGG - Intronic
928934035 2:36655987-36656009 GAATGGTTCACCAGGGAAACAGG + Intergenic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
929837468 2:45418711-45418733 GAGTTGTGCAAGAGGAAAGAAGG + Intronic
931645994 2:64422525-64422547 GAGTGTTTCAAGAGACAAAATGG - Intergenic
932199985 2:69817558-69817580 GAATGGCACAGGAGGGAAAATGG + Intronic
935029963 2:99312162-99312184 GAGTGGTTGAAGAGGTGAGAGGG - Intronic
935180782 2:100689470-100689492 GAGGAGCTCAAGAGGGAACAAGG + Intergenic
937238784 2:120446991-120447013 GCCTGTTTCAAGAGGGAAACAGG + Intergenic
937346396 2:121128558-121128580 TACTGGTCAAAGAGGGAAAATGG + Intergenic
938547916 2:132352350-132352372 GAGGGGTTCAATGTGGAAAACGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
940034232 2:149296367-149296389 GAGGGGTTAAAGAGGGGAAGGGG + Intergenic
940330121 2:152465430-152465452 AAGTGGTTAAAGTGGGACAAAGG + Intronic
940362995 2:152815738-152815760 AAGTGGTTAAAGAGGTGAAAAGG + Intergenic
940958724 2:159758159-159758181 GAGGGTTTCAAATGGGAAAATGG - Intronic
941332917 2:164202009-164202031 GAGAGGTGCAAGATGGACAATGG + Intergenic
941430859 2:165412295-165412317 GAGTCTTTGAACAGGGAAAATGG + Intergenic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
942634423 2:177987232-177987254 AAGGGGATGAAGAGGGAAAAGGG + Intronic
943436635 2:187872079-187872101 GATTGATTGAAGAAGGAAAATGG - Intergenic
945073892 2:206017795-206017817 GAGTGGTTCAAGAGGATATCTGG + Exonic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
946216474 2:218187597-218187619 GAGGGGTTCTAGATGGAAACTGG + Intergenic
946565167 2:220956529-220956551 AAGTGGTGAAAGAGGGATAAAGG - Intergenic
947212024 2:227717334-227717356 GAGTGCTTCAAGTTTGAAAAAGG - Intronic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
948530173 2:238599183-238599205 GAGAGGGACATGAGGGAAAAAGG + Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170902234 20:20475606-20475628 GAGAGCTTAAAGGGGGAAAAAGG + Intronic
1171236439 20:23529210-23529232 GAGTGGTTTGGCAGGGAAAATGG + Intergenic
1171496339 20:25558597-25558619 AAGTTGGTCAAGAAGGAAAAAGG - Intronic
1171746996 20:29000540-29000562 GAGTGTTTCAAAAGGCTAAATGG - Intergenic
1172271199 20:33656721-33656743 GAGTGGTTCCAGTTGGACAATGG - Intergenic
1173084629 20:39904034-39904056 GAGTTGTTCAAGACTGAAAGAGG - Intergenic
1174945093 20:54976313-54976335 GGGTGGTTAGAGAGAGAAAAAGG + Intergenic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1182371689 22:29815808-29815830 GTCTTGTTCAAAAGGGAAAACGG + Intronic
1183317678 22:37145892-37145914 GAGAGGCTCAAGAGAGAGAAGGG - Intronic
1183611207 22:38907619-38907641 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
949098580 3:115819-115841 GAGTGGTTCAGTAGGAACAATGG + Intergenic
949289234 3:2444511-2444533 GAGTGGTGAATGAGGGAAAGTGG + Intronic
949635145 3:5974364-5974386 GAGGGGATCAAGGGGAAAAAAGG + Intergenic
949636504 3:5987857-5987879 GAGTGGTGACAGTGGGAAAAAGG - Intergenic
949986184 3:9543144-9543166 GAGTGCTCCGAGAGAGAAAAAGG - Intronic
950626133 3:14248513-14248535 GAGTGGTTCAAAAGGGTAGAGGG - Intergenic
951285718 3:20810692-20810714 GAGTCATTCTAGAAGGAAAAAGG - Intergenic
951667983 3:25148061-25148083 GAGTGGTTTAAGTGGCAAAAGGG - Intergenic
953246017 3:41193864-41193886 GAGTGGTACAAAATAGAAAACGG + Intergenic
954603602 3:51891955-51891977 GAGTGATTCAGGAAGGAAAGGGG - Intergenic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
955486399 3:59438887-59438909 GAGTGGTCCAAGAGGGATCTCGG - Intergenic
956339927 3:68211088-68211110 GAGTGATCCAAGAGAGAACAAGG + Intronic
957394311 3:79619655-79619677 GAGAGGTCCAATAGAGAAAAAGG - Intronic
959168536 3:102813481-102813503 GAATGGTTGAAGAGAAAAAAAGG + Intergenic
960071298 3:113434204-113434226 GAGTGCTACAAAAAGGAAAATGG + Intronic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962638038 3:137350942-137350964 GATTTGTGAAAGAGGGAAAACGG - Intergenic
963362303 3:144289934-144289956 CAGTGGTCCAAGGGGGAGAATGG + Intergenic
964206643 3:154182326-154182348 GTGGGATTCATGAGGGAAAAAGG + Intronic
964588817 3:158337807-158337829 AAGTGGTTCATGAGGGTATAAGG - Intronic
964995859 3:162879783-162879805 GAGTGTTTCAAGAATGAAAGGGG + Intergenic
968168282 3:196486715-196486737 GAGAGGTGGAAGAAGGAAAAAGG + Intronic
968277760 3:197453769-197453791 GAGTGGTTCCAAGGAGAAAATGG + Intergenic
970197299 4:13564313-13564335 GAGTGGTACAATTGGGATAAGGG + Intergenic
971197830 4:24486328-24486350 GAGTGGTTCCTGAGGCAAAAAGG - Intergenic
971711638 4:30120282-30120304 GAGTGGTTCAGAAGGGGCAAAGG + Intergenic
972061016 4:34873564-34873586 GAATGGATCAAGAGGAAGAAAGG + Intergenic
975618329 4:76270063-76270085 GATTGGTTTAAGAGAGAAAAGGG + Intronic
978730733 4:112023720-112023742 GAGGGTTTTAAGAGAGAAAAAGG + Intergenic
978781683 4:112562208-112562230 CAGTGGTTAAAAAGAGAAAAGGG - Intronic
979973711 4:127169521-127169543 TAGTGGTTGGAGAGGGAAAGAGG - Intergenic
980670013 4:135993481-135993503 GAGAGCTACAAGACGGAAAAAGG - Intergenic
982219600 4:153113229-153113251 GAGTGGCTCAGGTGGGAAACAGG - Intergenic
982463791 4:155704986-155705008 GAGAGGTTGATGTGGGAAAATGG - Intronic
983595600 4:169463484-169463506 GAGTGGTTCATGAGAAAAAAAGG + Intronic
983617704 4:169725989-169726011 GAGTGGGTGAAGAATGAAAAAGG + Intergenic
984830410 4:183967457-183967479 GAGTGGTGCAAGAGGAAGAAAGG + Intronic
985198990 4:187464530-187464552 GAAGGGAACAAGAGGGAAAATGG - Intergenic
987173903 5:15287156-15287178 GAGTAGGACAAGAGGGGAAACGG + Intergenic
988281559 5:29154753-29154775 AAGTGGTTGAAGAGGGGAAGGGG - Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
989759894 5:45001251-45001273 GATTGTTACAAGAGTGAAAAGGG - Intergenic
990221511 5:53595727-53595749 GATTTGTGCAAGAGGGATAAGGG - Intronic
991008698 5:61858748-61858770 CAGTGGTTCAAGTAGAAAAATGG + Intergenic
991147002 5:63318732-63318754 AAGGAGTTCAAAAGGGAAAAAGG + Intergenic
993725141 5:91358531-91358553 GAGTCTTTCAAGAGGAAAAAGGG - Intergenic
994032590 5:95161441-95161463 AAGGGGGTCAAGAGGGAAAGGGG + Intronic
994959925 5:106586545-106586567 GAGTGGATTAAGAAGGAAAGTGG + Intergenic
995522156 5:113018990-113019012 GTGTGGTTCTAGAGTGAAATGGG + Exonic
996782759 5:127206545-127206567 GAGTGTTTATAGAGGGAAAGCGG + Intergenic
996994170 5:129674869-129674891 AAATGGTTCAAGATGGAAAGTGG - Intronic
997710997 5:136004659-136004681 GAGTGGCTCATGAAGGGAAAAGG + Intergenic
998330830 5:141325298-141325320 AAGTGTTACAAGAGGAAAAAGGG + Intergenic
1001666955 5:173441110-173441132 GAGTGTTTCAGGAGGAAGAATGG - Intergenic
1001770744 5:174294071-174294093 GAGTCCTTCAAGGTGGAAAAGGG + Intergenic
1002896978 6:1384988-1385010 GGGTGCTTGAAGGGGGAAAAAGG - Intergenic
1004721053 6:18267471-18267493 GAGAGGTTCAAGAGTGAGAGGGG + Intergenic
1005053823 6:21711126-21711148 CAGAGGTTAAAGAGGGAACAGGG + Intergenic
1005234112 6:23740184-23740206 GAGTGCTTCCTGAGGGCAAAGGG - Intergenic
1006728587 6:36218101-36218123 GAGTGGGGGAAGAGAGAAAAAGG - Intronic
1006880126 6:37331952-37331974 GAGTGGGTCATCATGGAAAAGGG - Exonic
1010991659 6:82486027-82486049 GAGAGGATCAAGGAGGAAAAAGG - Intergenic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1013402505 6:109812565-109812587 AAGTGTTTCAAGAAGGAAAATGG + Intronic
1013533958 6:111046640-111046662 GAGACGTTCATGAAGGAAAATGG + Intergenic
1013797169 6:113900754-113900776 AATTGGTTGAAGAAGGAAAAGGG - Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1015333799 6:132011384-132011406 TAGAAGTTCAAGAGGAAAAATGG + Intergenic
1015379023 6:132545722-132545744 CAGAGGTTCAAGAGAGCAAACGG - Intergenic
1015485628 6:133766797-133766819 GAGTGTAAGAAGAGGGAAAAAGG + Intergenic
1016063149 6:139651092-139651114 GAGAGGTTCAGCAGGGAAAGTGG - Intergenic
1017533564 6:155322236-155322258 AAGAGGTTCAAGAGGCAAGAAGG + Intergenic
1018628334 6:165801813-165801835 GAGTGGTGCAGGAGAGAAAGAGG + Intronic
1021521969 7:21547832-21547854 GAGTGATTCAAGAACCAAAAGGG - Intronic
1022232073 7:28423818-28423840 GAGTGGCTCCACAGGGAGAAAGG + Intronic
1022515101 7:30970254-30970276 AAGTGGTTCCAGAGGAAACAAGG + Intronic
1022614464 7:31915080-31915102 GATTGGTTCCAGAGGGATGATGG - Intronic
1022953073 7:35356631-35356653 GAGTGGATGAAGACGGAAACTGG + Intergenic
1023542629 7:41282709-41282731 GAGTATCTCAAGAGGGAACAGGG + Intergenic
1023542636 7:41282756-41282778 GAGTATCTCAAGAGGGAACAGGG + Intergenic
1024180625 7:46890290-46890312 GAGAGCTGGAAGAGGGAAAATGG + Intergenic
1024231371 7:47366521-47366543 GAGTGATGCAAGTGGGTAAAGGG - Intronic
1027173283 7:75887966-75887988 GAATGGAACAAGAGAGAAAATGG - Intronic
1027185553 7:75968708-75968730 GAGTGGTCCAGGGGGGAAAAGGG - Intronic
1027925521 7:84457173-84457195 GAGTGGATGAATAGGAAAAATGG + Intronic
1028896497 7:96047595-96047617 GAGTGGTTGCAGAGTGAAAAGGG + Intronic
1029306287 7:99622402-99622424 GTGTGGTACCAGAGTGAAAAGGG + Intronic
1029865575 7:103624409-103624431 GAGTGGGACATGAGGAAAAAAGG - Intronic
1029982858 7:104895540-104895562 CAGAGGTGCAACAGGGAAAAGGG + Intronic
1030192547 7:106824016-106824038 TAGTGGGTCAATAGGGATAATGG + Intergenic
1031348050 7:120693569-120693591 AAGTGGAGGAAGAGGGAAAAAGG + Intronic
1032993582 7:137421086-137421108 GAGTGTTTGAAGGAGGAAAAAGG - Intronic
1034934296 7:155188635-155188657 GAGAGGTTAGAGAGGAAAAAGGG - Intergenic
1035127102 7:156616656-156616678 AAGTGGTTCCAGCGGGGAAAGGG - Intergenic
1038032151 8:23651757-23651779 GAGGGGGTTAAAAGGGAAAAGGG - Intergenic
1039510236 8:38086011-38086033 GCGTGGTTCATGCAGGAAAACGG - Intergenic
1039818615 8:41116680-41116702 GAGGGCTTAAAGAGGAAAAAGGG - Intergenic
1044068419 8:87725507-87725529 GAGTGATTTAAGAAGAAAAAAGG + Intergenic
1045409933 8:101906723-101906745 GAGTGGGTCAAGAGAAAATAAGG + Intronic
1047347074 8:124038920-124038942 GAGTGGGTAAAGAAGTAAAAAGG + Intronic
1047858826 8:128941979-128942001 GAGTGGAGCAAGAGAGAGAAGGG - Intergenic
1049825101 8:144662853-144662875 GAGTGGTTCAAGGTGGATAATGG - Intergenic
1049825176 8:144663098-144663120 GAGTGGGCCAAGGGGGATAATGG - Intergenic
1050142119 9:2527096-2527118 GAGGGGTTCGAGTGGGATAAAGG - Intergenic
1050146047 9:2568792-2568814 CAGGGGTTGAAGAGAGAAAATGG - Intergenic
1050416539 9:5423603-5423625 GAGTGTTTCAAGAAGAAAGAAGG - Intronic
1050839345 9:10127712-10127734 GGGTGGCACAAGTGGGAAAATGG - Intronic
1050908349 9:11034486-11034508 GAAAGTTTCAGGAGGGAAAAAGG - Intergenic
1051238091 9:15023175-15023197 GAGTGGGTGAAGAATGAAAAAGG - Intergenic
1051861283 9:21627661-21627683 GAGTGCTTCCTGGGGGAAAATGG - Intergenic
1053021381 9:34696854-34696876 GGGTGGGTCCTGAGGGAAAAAGG - Intergenic
1053605638 9:39655809-39655831 AAGGGGTTTAAGAAGGAAAAAGG + Intergenic
1053863557 9:42412439-42412461 AAGGGGTTTAAGAAGGAAAAAGG + Intergenic
1054247905 9:62686606-62686628 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1054562019 9:66721131-66721153 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1054915859 9:70494729-70494751 GAGTGCCTCAAGAGGGCAAATGG - Intergenic
1055276136 9:74619156-74619178 TGGTGGTTGAAGAGTGAAAAAGG - Intronic
1056453331 9:86737683-86737705 TAATGGTTGAAGAGGGATAAAGG - Intergenic
1056833766 9:89937315-89937337 AACTGGTTCAAGAGGGACATAGG - Intergenic
1057957183 9:99419952-99419974 AAGTGATTCAAGAAGGAACAAGG - Intergenic
1059024783 9:110614768-110614790 GAGTGGTTTGGGAGGAAAAATGG + Intergenic
1059639803 9:116205339-116205361 GAAAGCTTCAAGAGAGAAAAAGG - Intronic
1060389667 9:123267842-123267864 GTGGGGTTCAAGAGGGAATGAGG - Intronic
1061690090 9:132320487-132320509 GGGAGGTTGAGGAGGGAAAATGG + Intronic
1186991720 X:15076783-15076805 GAGTGTCTCAAGGGGGAAAGTGG + Intergenic
1190444017 X:50504933-50504955 GAGTGGAGGAGGAGGGAAAAGGG - Intergenic
1194311395 X:92312484-92312506 GATTGGTTCCCGTGGGAAAAAGG + Intronic
1196286873 X:113892940-113892962 TATTGTTTCATGAGGGAAAATGG + Intergenic
1196489173 X:116247291-116247313 GAGTGGTTAACGACAGAAAAAGG + Intergenic
1197051803 X:122068090-122068112 GAGTGTTTCCAAAGGCAAAATGG + Intergenic
1197267375 X:124389559-124389581 TTGTGATTCTAGAGGGAAAAAGG - Intronic
1197847192 X:130815120-130815142 GAGTCGATCAAGAGGAAGAAAGG + Intronic
1197927061 X:131657548-131657570 GAATGGATCAAGAGGAAGAAAGG + Intergenic
1198079330 X:133224245-133224267 AAGTGATTCAACAAGGAAAAGGG + Intergenic
1200181765 X:154155212-154155234 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200187414 X:154192326-154192348 GAGTGGGTCAGGGGGGCAAATGG - Intergenic
1200193063 X:154229466-154229488 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200198818 X:154267270-154267292 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200516261 Y:4147520-4147542 TAGAGCTTCATGAGGGAAAAAGG + Intergenic
1200619670 Y:5426705-5426727 GATTGGTTCCCGTGGGAAAAAGG + Intronic