ID: 1181954804

View in Genome Browser
Species Human (GRCh38)
Location 22:26580403-26580425
Sequence CCCTGGGTATCCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 343}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181954789_1181954804 26 Left 1181954789 22:26580354-26580376 CCTGCACCCACATCTTAGCTACA 0: 1
1: 0
2: 0
3: 21
4: 180
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954798_1181954804 -8 Left 1181954798 22:26580388-26580410 CCCTTCAGTCAAGGCCCCTGGGT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954791_1181954804 19 Left 1181954791 22:26580361-26580383 CCACATCTTAGCTACACAGCCAT 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954788_1181954804 27 Left 1181954788 22:26580353-26580375 CCCTGCACCCACATCTTAGCTAC 0: 1
1: 0
2: 3
3: 41
4: 224
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954790_1181954804 20 Left 1181954790 22:26580360-26580382 CCCACATCTTAGCTACACAGCCA 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954795_1181954804 -5 Left 1181954795 22:26580385-26580407 CCGCCCTTCAGTCAAGGCCCCTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954794_1181954804 -4 Left 1181954794 22:26580384-26580406 CCCGCCCTTCAGTCAAGGCCCCT No data
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954799_1181954804 -9 Left 1181954799 22:26580389-26580411 CCTTCAGTCAAGGCCCCTGGGTA 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343
1181954793_1181954804 0 Left 1181954793 22:26580380-26580402 CCATCCCGCCCTTCAGTCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181954804 Original CRISPR CCCTGGGTATCCAGGGAAGA AGG Intronic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
900437078 1:2635839-2635861 CCCTGGGTATCCAGGGCAGGAGG + Intergenic
901024064 1:6269902-6269924 CCCTGGGCACTCAGGGAGGAAGG - Intronic
901638311 1:10680500-10680522 CCCTAGGGATCCTGGGAGGATGG + Intronic
901758458 1:11455560-11455582 TGCTGTGGATCCAGGGAAGACGG + Intergenic
901768598 1:11519295-11519317 TCCTGGGTACCCAGGGAGGGTGG - Intronic
901942878 1:12677173-12677195 CCCTGGGAGGCCAAGGAAGATGG + Intergenic
902989665 1:20177822-20177844 GCCTGGGTATCAAGGAAGGAAGG - Intergenic
903235674 1:21949153-21949175 ACCTGGTTAGCCTGGGAAGATGG + Intergenic
903273194 1:22204916-22204938 CCCTGGGTCTTCGGGGGAGAAGG - Intergenic
903479090 1:23639982-23640004 CCCTGGGTTTTCAGGAAAGTGGG + Intronic
903643528 1:24876417-24876439 CCCTGGGGGGCCAGGGAAGGAGG + Intergenic
903790584 1:25890278-25890300 CACTGGGCAATCAGGGAAGAGGG - Intronic
903861104 1:26364952-26364974 AAGTGGGTATCCAGGGTAGAAGG + Exonic
904906242 1:33899337-33899359 CCTTGGGTATCCTGGAGAGATGG - Intronic
905437570 1:37967949-37967971 CCCTGTGTATCCAGGGTTAAAGG - Intronic
905731625 1:40302702-40302724 CCCTGGGTACCCAGGCAAGCAGG - Exonic
906526619 1:46497045-46497067 CCCTGGGTGTCAATGGCAGAGGG - Intergenic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
914007313 1:143743614-143743636 CAGAGGGTATCCTGGGAAGATGG - Intergenic
914345174 1:146793008-146793030 ACCTGGGTTTGCATGGAAGATGG - Intergenic
914646129 1:149654096-149654118 CAGAGGGTATCCTGGGAAGATGG - Intergenic
915276112 1:154789364-154789386 CCCTGGATATCCTGGCAAAAGGG - Intronic
915490152 1:156246234-156246256 CCCTAGGTGTTCTGGGAAGATGG - Exonic
915511736 1:156390416-156390438 CCCTGGAAATCCAGGCAAAAGGG - Intergenic
919922493 1:202174774-202174796 CCCTGGGAATCCAAGGAGCAAGG - Intergenic
920118303 1:203636866-203636888 CCCTGGTCATCCTGGGCAGAAGG - Intronic
921477533 1:215629222-215629244 CCCTGGGTTTCTTGGTAAGAAGG + Intronic
921698789 1:218244078-218244100 GCCTGATTATCCTGGGAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923684907 1:236147233-236147255 CCCTGGGCTGCCTGGGAAGATGG - Intronic
924277859 1:242406219-242406241 CCCTGGGTAGACAGAGAAAATGG - Intronic
924342410 1:243050047-243050069 CCCTGGGCTTTCAGGGCAGATGG - Intergenic
1063866673 10:10372770-10372792 TCCTGGGTATTAAGGAAAGAGGG - Intergenic
1067683975 10:48456489-48456511 GCCTGGGTACCCAGGGCAGTTGG - Intronic
1067741402 10:48898361-48898383 CCCTGGGCCTCCAGGGCAGCTGG + Intronic
1068554137 10:58439276-58439298 TCTGGGATATCCAGGGAAGATGG + Intergenic
1068938880 10:62661623-62661645 TCCTGGGGACTCAGGGAAGAGGG + Intronic
1069082741 10:64105661-64105683 CCATTCGTATCCAGAGAAGAGGG + Intergenic
1071011430 10:80944825-80944847 CCATGGGTATCCAGGTGTGAGGG + Intergenic
1071860593 10:89668830-89668852 CCCTGGGTATTCAGGGGACAGGG - Intergenic
1072032996 10:91539169-91539191 CCCTGGTTTTCCAGGGAAACAGG - Intergenic
1072533728 10:96343794-96343816 TCTTGGTTATTCAGGGAAGAGGG + Exonic
1073329401 10:102660889-102660911 CCCTAGGCAGCCAGGGAAGCAGG + Intergenic
1074421027 10:113309128-113309150 CCCTGGGCCTGCAGGGATGAAGG + Intergenic
1075950320 10:126471595-126471617 CCCTGTGTATTCAGAGAAAAAGG + Intronic
1075959835 10:126558825-126558847 CCCTGGGGATCCAGAGTACAAGG - Intronic
1076014640 10:127018019-127018041 CCAGGGGTATCCTGGGGAGAGGG - Intronic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076531916 10:131150538-131150560 CCCTGGGTGTTCAGGAAAGCTGG - Intronic
1076797357 10:132804832-132804854 CCCTGTGTTTCCAGAGAGGACGG + Intergenic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1078949440 11:16113125-16113147 CCCTGGCTATGAAGGGAACAGGG - Intronic
1082002841 11:47403215-47403237 GCCTGTGTATCCAGGGGACAAGG + Intergenic
1082857234 11:57818997-57819019 CCCTGGTAATCCAGGTAATATGG - Exonic
1083396871 11:62398504-62398526 CACTGGGTAGCCAGGGAATGTGG - Intergenic
1083760067 11:64810715-64810737 CCCTGAGTATCTCGGGAAGGAGG - Intronic
1084291258 11:68170045-68170067 CCCTGGCTATCCAGAAAGGAGGG + Intronic
1085039320 11:73317635-73317657 CCCTGGGTCCCCTGGGAAGCAGG + Intronic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085809209 11:79665375-79665397 CTTTGTGTATCCAGGTAAGATGG + Intergenic
1085883980 11:80500480-80500502 CCCTGGGCATCCAGGGCTGTGGG - Intergenic
1087013942 11:93538387-93538409 CCCTGTGCCACCAGGGAAGAGGG + Intronic
1090393344 11:126403659-126403681 CCCTGGTCATGCAAGGAAGATGG + Intronic
1090737621 11:129624101-129624123 CTCTGTGCATCCAGGGAAGCTGG + Intergenic
1091095394 11:132816605-132816627 ACCTGGGTGTTCAGGGAACAAGG + Intronic
1091307230 11:134544023-134544045 CCCTGGCTATCAAGTGGAGAAGG - Intergenic
1091644846 12:2265599-2265621 CCCTGCATTTGCAGGGAAGATGG - Intronic
1093253991 12:16842824-16842846 CCCTGGGTAAGCAGGGAAGCAGG + Intergenic
1093547856 12:20369251-20369273 CACTGGGAATTCAGTGAAGAGGG + Exonic
1095259550 12:40082714-40082736 CCCTGGGGATCCATGCAAGCTGG + Intronic
1095572633 12:43700395-43700417 TGCTGGGAATCCAGGAAAGAAGG + Intergenic
1096229011 12:49887277-49887299 TCCCGAGGATCCAGGGAAGAGGG + Intronic
1096522101 12:52190139-52190161 CCCTGGGTACCCAGAGGGGAAGG - Intronic
1096743771 12:53712641-53712663 CCCAGGGAAGTCAGGGAAGAGGG + Intronic
1097343055 12:58461486-58461508 CCCTCAGTATCCATGGGAGATGG + Intergenic
1099232488 12:80043353-80043375 CCCTGTGGATCAAGGCAAGAAGG + Intergenic
1101496542 12:105259858-105259880 CCATGGTTATCCAGGGAGTAGGG - Intronic
1102454587 12:113063719-113063741 CCCAAGGTTTCCAGGGAAGGAGG - Intronic
1102778915 12:115546641-115546663 CCCTGGGCCCCCAGGGAAAATGG + Intergenic
1102974596 12:117197443-117197465 CACTGGGAAGCCAGGGAGGAGGG - Intergenic
1106175967 13:27331940-27331962 CCCTCAGTATCCATGGAGGATGG - Intergenic
1106387553 13:29302479-29302501 CCCTGGGATCCCTGGGAAGATGG + Intronic
1106589959 13:31090536-31090558 CCCTGGGGAGCCTGGGAAAAGGG - Intergenic
1114075060 14:19157425-19157447 GCCTGGGTACCCACGGACGAAGG + Intergenic
1114087209 14:19242552-19242574 GCCTGGGTACCCACGGACGAAGG - Intergenic
1114278617 14:21169847-21169869 CCAGGGGTTCCCAGGGAAGAGGG - Intergenic
1114530535 14:23392798-23392820 CCTTGGGTATGCTGGGAATAAGG - Intronic
1115788198 14:36849956-36849978 CCCTGGGGATCAAGTGAAGGAGG + Intronic
1116253381 14:42516554-42516576 CCATGGGTATCCAGGCTTGAGGG + Intergenic
1119023861 14:71137235-71137257 CCATGGGTATCCAGGCTTGAAGG + Intergenic
1121102497 14:91259739-91259761 CCATGGGCATCGGGGGAAGAAGG - Intergenic
1121169173 14:91838440-91838462 CCTTAGGTATCAAGGGAAGCTGG - Intronic
1121786019 14:96661615-96661637 CCCTGGGTATCATTGGAATATGG - Intergenic
1122247821 14:100416770-100416792 CCCTGGGCATCTGGGGACGATGG - Intronic
1122341019 14:101028560-101028582 TCCGGGGTATCCAGGGTAGGCGG + Intergenic
1202899331 14_GL000194v1_random:26508-26530 GCCTGGGTACCCACGGATGAAGG - Intergenic
1124404213 15:29379643-29379665 CCCAGGGAAGCCAGGGAAGCAGG - Intronic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1125547040 15:40513429-40513451 CCCTGGGTGTGCCGGGAGGAAGG - Intergenic
1125728685 15:41881135-41881157 CCCTGGGGATGCCTGGAAGATGG - Exonic
1126067862 15:44839703-44839725 CCCTGGGTCCCCAGGGAGGAGGG - Intergenic
1126091966 15:45060872-45060894 CCCTGGGTCCCCAGGGAGGAGGG + Intronic
1126495793 15:49289451-49289473 CCCTGGGTCTTCTGGTAAGAGGG - Intronic
1129175379 15:73836175-73836197 CACCGGGAATCCAGAGAAGAAGG - Intergenic
1131706552 15:95002240-95002262 GCCAGGGTATCAGGGGAAGATGG + Intergenic
1131746823 15:95457675-95457697 CACTGGGCCTCCGGGGAAGAGGG - Intergenic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1132688669 16:1172737-1172759 CCCTGGGTGCCCCGGGGAGAAGG - Intronic
1132988957 16:2783350-2783372 TCCTGGGGAGCCAGGGAAGTGGG - Intergenic
1133209759 16:4256985-4257007 CCCTGGGTATTCTGTAAAGATGG - Intergenic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134347924 16:13408916-13408938 CCATGGGTATCCAGGCTTGAGGG - Intergenic
1136519488 16:30786797-30786819 GCCTGGGGATTCTGGGAAGAGGG - Intronic
1136665453 16:31807979-31808001 GCCTGGGTATCCTGGGATGGCGG + Intergenic
1138414139 16:56861588-56861610 GGCTGGGAATCCAGGGAAGTGGG + Intergenic
1138977871 16:62230271-62230293 CCCTGGGTATCCAGGCTTGAGGG - Intergenic
1139340504 16:66265022-66265044 CCATGGGACTCCAGGGGAGAAGG + Intergenic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1139988820 16:70922284-70922306 ACCTGGGTTTGCACGGAAGATGG + Intronic
1140339163 16:74140074-74140096 CCATGGGTATCCAGGCTTGAGGG + Intergenic
1141826212 16:86482177-86482199 GCCTGGGCCTGCAGGGAAGAGGG + Intergenic
1141861353 16:86718584-86718606 CCCGGGGTCTGCAGGGAAGCAGG - Intergenic
1142341580 16:89526652-89526674 CCCTGGGTATCCATGGGGGCTGG + Intronic
1142758297 17:2028616-2028638 CCCTGGGGATCCAGAGAAGCTGG + Intergenic
1144709666 17:17393202-17393224 CCCTGGCTTTCCTGGGCAGATGG + Intergenic
1145010455 17:19364918-19364940 CCATAGGCATGCAGGGAAGAGGG - Intronic
1148063232 17:44850776-44850798 CCCTGGGGACCCAGGCAGGAAGG + Exonic
1151889027 17:76941315-76941337 CCCTGGGTCTCCAGCGAACGTGG + Intronic
1152335084 17:79696135-79696157 CACCGGCTCTCCAGGGAAGAGGG - Intergenic
1152339429 17:79716095-79716117 CCCTGGGGGTACAGGGCAGAGGG + Intergenic
1152515831 17:80824066-80824088 CTCTGGGTTTCCAGGGTTGAGGG - Intronic
1153103206 18:1497650-1497672 CCCTGGGTCACAAGGGCAGAGGG + Intergenic
1153923283 18:9810167-9810189 TGCTGGGTAGTCAGGGAAGAAGG + Intronic
1154212761 18:12394260-12394282 CCCTGGGTACACAGAGATGAAGG + Intergenic
1155314575 18:24558616-24558638 CCGTGGGTATCCAGGCTTGAGGG + Intergenic
1156281380 18:35642748-35642770 GCTTGGGGAACCAGGGAAGAGGG - Intronic
1157291632 18:46413633-46413655 CCCTGGGAACCCAGGGCAAAGGG + Intronic
1157719581 18:49913670-49913692 CCATGGGTATCCAGGCTTGAGGG - Intronic
1157810728 18:50693915-50693937 CCCTGGGGATCCAAGGAACAGGG - Intronic
1158177260 18:54670523-54670545 CCCTAGGTATCCAGCAGAGATGG + Intergenic
1160396769 18:78578041-78578063 TCCTGGGTTTCCAGCTAAGAAGG - Intergenic
1160426748 18:78783124-78783146 CCCCGGGTGTCCAGGCACGAGGG + Intergenic
1161284580 19:3462797-3462819 CCCTGGGATTCCTGGGACGATGG - Exonic
1161363841 19:3867664-3867686 ACCTGGGTTTCCAGGGAACTGGG - Intronic
1162861934 19:13512587-13512609 CCATGGGTATCCAGACCAGAAGG - Intronic
1163389523 19:17021906-17021928 CCCTGGGGATTTAGGGCAGAAGG + Intronic
1164286231 19:23820142-23820164 CCCTGGGAATGCAGGAAATAGGG - Intronic
1165943196 19:39425439-39425461 CCCTGTGGATCAAGGCAAGAAGG - Exonic
1165956251 19:39503694-39503716 CCCTGGCCTTTCAGGGAAGATGG - Intronic
1166787866 19:45380029-45380051 TCCTGGAAGTCCAGGGAAGAAGG - Exonic
1166809947 19:45508747-45508769 GCCTGGGTCCCTAGGGAAGAGGG - Intronic
1166844561 19:45718692-45718714 CCCAGAGTAGGCAGGGAAGAGGG - Intronic
1202648124 1_KI270706v1_random:159166-159188 GCCTGGGTACCCACGGATGAAGG + Intergenic
924960839 2:33032-33054 AGCTGGGGAACCAGGGAAGACGG - Intergenic
926002954 2:9348895-9348917 ACGTGGGTATCCATGGAAGGCGG - Intronic
926240434 2:11081008-11081030 CCCTGGGCGGCCAGGGCAGAGGG + Intergenic
927705512 2:25294187-25294209 GCCGGGGAAGCCAGGGAAGATGG - Intronic
927847838 2:26480469-26480491 GCCTGGATATCCATGGAAGCAGG + Intronic
927865565 2:26585231-26585253 CCCTGGGGAGCCAGGGACGGCGG + Intronic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928209345 2:29312092-29312114 CCCTGGGTAGCCTGGCAATATGG - Intronic
928883506 2:36123034-36123056 CCCTGGGAATCCTGGCAAGGTGG - Intergenic
929116548 2:38449245-38449267 ACCTGTGTTCCCAGGGAAGAGGG - Intergenic
929580381 2:43078558-43078580 CCAGGGGTATCCAGGGAGGAGGG - Intergenic
930028979 2:47046959-47046981 CCGTGGGTGACTAGGGAAGAAGG - Intronic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
932441035 2:71735364-71735386 GGCTGGGGATCCAGGGAGGAGGG + Intergenic
933296151 2:80493379-80493401 CCCAGGGTACCCAGAGAACATGG + Intronic
933846621 2:86332051-86332073 CCCTGGGAATACAGGGAAAAAGG - Intronic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935821378 2:106896272-106896294 CCCTGGATATCAGGAGAAGAAGG + Intergenic
935839141 2:107089976-107089998 CCATGAGTATCCAGGAATGATGG + Intergenic
938318771 2:130348071-130348093 CACTGGGTACCCAGGGAGGAGGG + Intergenic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
941077547 2:161022980-161023002 CCCTACATATCCAGGGAAGGAGG - Intergenic
945983765 2:216338516-216338538 ACCTGGGAATCCAGGGTTGATGG - Intronic
948119248 2:235516673-235516695 CCCAGGGTCTCCAGGTATGATGG - Intronic
948591557 2:239053908-239053930 CCCTGGGTGGCCAGGGCAGGGGG + Intronic
948648616 2:239424858-239424880 CCCTTGGTGTCCAGGCAGGAAGG - Intergenic
1170783669 20:19449233-19449255 CCCTGGGAATGCAGGGGAGCTGG - Intronic
1170804990 20:19621795-19621817 GCCAGGGGTTCCAGGGAAGACGG - Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1172005825 20:31818749-31818771 CCCTGAGTAGCCATGGGAGATGG - Intergenic
1174182889 20:48686226-48686248 CCCTGGTCCTCCAGGGTAGAAGG - Intronic
1174332576 20:49831820-49831842 CCCTGGCTTTCCAGGGAGTATGG + Intronic
1174611317 20:51800976-51800998 CCCGGGGTTTCCCGAGAAGACGG - Intronic
1174883045 20:54302096-54302118 CCTTGGGTACCCAGGACAGAGGG + Intergenic
1176295433 21:5069640-5069662 AGCTGTGTGTCCAGGGAAGAAGG + Intergenic
1176603726 21:8813528-8813550 GCCTGGGTACCCACGGATGAAGG - Intergenic
1176618712 21:9041271-9041293 GCCTGGGTACCCACGGATGAAGG - Intergenic
1177578869 21:22994078-22994100 ACCCGGGTTTCCAGGGAAGTGGG - Intergenic
1179106325 21:38403827-38403849 TCCTGGGTAGCCAGGGAGGCTGG - Intronic
1179584076 21:42364179-42364201 CCCTGGGCACCCTGGGACGATGG - Intronic
1179861617 21:44192484-44192506 AGCTGTGTGTCCAGGGAAGAAGG - Intergenic
1179959713 21:44761229-44761251 CCCTGGAGCTCCTGGGAAGAGGG + Intergenic
1180290708 22:10850339-10850361 GCCTGGGTACCCACGGACGAAGG + Intergenic
1180346009 22:11705079-11705101 GCCTGGGTACCCACGGATGAAGG - Intergenic
1180353781 22:11823336-11823358 GCCTGGGTACCCACGGATGAAGG - Intergenic
1180384464 22:12169023-12169045 GCCTGGGTACCCACGGATGAAGG + Intergenic
1180493509 22:15879761-15879783 GCCTGGGTACCCACGGACGAAGG + Intergenic
1181080052 22:20407942-20407964 CCCAGTGCATTCAGGGAAGATGG + Exonic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1182280513 22:29215453-29215475 CCATGGGTGTCCAGGGCAGTGGG + Intronic
1182656881 22:31897719-31897741 CTCTGGGTATCCAGTCAACACGG + Intronic
1182854901 22:33508383-33508405 TCATGGGTAACCAGGTAAGAGGG + Intronic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1183806458 22:40215585-40215607 CCCTGAGGATGCAGCGAAGATGG - Intronic
1184770906 22:46595877-46595899 CCCTGGGTAAGCTGGGAAGGTGG - Intronic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
950086398 3:10261266-10261288 ACCTGGATAACCAGAGAAGAAGG + Intronic
950219495 3:11183653-11183675 CCCTGGAAATCAAGGAAAGAAGG - Intronic
950508055 3:13408007-13408029 CTCTGAGTGTCCATGGAAGATGG - Intronic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
952859858 3:37803998-37804020 TCCTGCCTTTCCAGGGAAGAAGG + Intronic
953042694 3:39268970-39268992 CCCTGGGTATCCTGGGAATTTGG + Intronic
953883665 3:46704151-46704173 CCCTGGGTGTCTAGGGGACACGG - Intronic
953883697 3:46704257-46704279 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883750 3:46704447-46704469 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883801 3:46704612-46704634 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883810 3:46704639-46704661 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883833 3:46704721-46704743 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883842 3:46704749-46704771 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883867 3:46704831-46704853 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883876 3:46704858-46704880 CCCTGGGTGTCTAGGGGACATGG - Intronic
956080336 3:65549763-65549785 CCCTGGGTAGCCAGGGTAAGAGG + Intronic
956408409 3:68952650-68952672 CCTTGGGTATCCAGTGCAGTGGG - Intergenic
959254135 3:103989336-103989358 CCCTGGGTATTCAGGCATGAGGG + Intergenic
959575088 3:107925445-107925467 CCGTGGGTATCCAGGCTTGAGGG + Intergenic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
960172736 3:114481797-114481819 GCCTGGGTCACCAGGGAAGCTGG + Intronic
960673158 3:120171194-120171216 CCCTGGCTATAGAGGCAAGAGGG + Intronic
961447416 3:126987444-126987466 CCCTGGCAATCCAGGAAGGAGGG + Intergenic
961784808 3:129341357-129341379 CCCTGGGTACCCAGCAGAGAGGG + Intergenic
962389296 3:134958131-134958153 CCCTGGGTTTCCAGGCATGAAGG - Intronic
962621890 3:137188559-137188581 GCATGGGGATCTAGGGAAGAGGG - Intergenic
965832389 3:172807041-172807063 CCCTTGGTATCCACGGGGGACGG + Intronic
966772634 3:183517671-183517693 CCCTGAGTTTCCAGAGAAGACGG + Intronic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
968456185 4:701305-701327 CCCTGTGGATTCTGGGAAGATGG - Intergenic
969044585 4:4327685-4327707 CCCTGGGAGTTCAGGGAAGAGGG - Intergenic
969254328 4:5992116-5992138 CCCTGGGCTTCAAGGGAAGGGGG + Intergenic
969350728 4:6596614-6596636 CTCTGGGCGTCCAGGGAGGATGG - Intronic
969455359 4:7297100-7297122 CCATGGGCATCCAGGGGAGGTGG - Intronic
969523962 4:7694842-7694864 GACTGGGTGTCCAAGGAAGAGGG - Intronic
969721935 4:8896865-8896887 CCTTGGGCATGCAGGGCAGAAGG + Intergenic
970046598 4:11861556-11861578 CCATGGGTATCCAGGCATGAGGG - Intergenic
972905985 4:43747549-43747571 CCCCCAGTCTCCAGGGAAGAGGG - Intergenic
973374396 4:49277316-49277338 GCCTGGGTACCCACGGATGAAGG + Intergenic
973383015 4:49332925-49332947 GCCTGGGTACCCACGGATGAAGG - Intergenic
976902418 4:90195438-90195460 CCAGGGATATCCAGGGAGGAAGG + Intronic
978829440 4:113066715-113066737 CCCTGCACATCCAGTGAAGAAGG + Intronic
978914331 4:114105213-114105235 CCCTGGGGACCCAGGGAACAGGG + Intergenic
979139429 4:117153276-117153298 GCCTGGGTATGCAGAAAAGAGGG + Intergenic
981686681 4:147462406-147462428 CACTGGATATCCATGGAAGATGG + Intergenic
986028389 5:3872190-3872212 CCCTGGGAATCAAGGAAAGGTGG + Intergenic
986709651 5:10479552-10479574 CCTCGGGTTTCCAGGGAAGCAGG - Intergenic
987268422 5:16279879-16279901 CTCTGGGTCTCCAGGGATCATGG - Intergenic
987271523 5:16314448-16314470 CCCTGGGTATCCAGGCTTGGGGG - Intergenic
988617188 5:32785985-32786007 CCCAAGGCACCCAGGGAAGAAGG + Intronic
989125536 5:38049097-38049119 CCTTGGGTATGCAGGGGAGTGGG + Intergenic
989735041 5:44693856-44693878 CCATGGGTATCCAGGCTTGAGGG - Intergenic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
990696742 5:58426583-58426605 GCCTTGTTAGCCAGGGAAGAAGG - Intergenic
991006394 5:61832374-61832396 CCCTGGACTTCCAGAGAAGATGG - Intergenic
992816671 5:80447638-80447660 CCTTGGGTAGGCAGGGAGGAGGG - Intronic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
996273841 5:121640556-121640578 CCCTGATTATCCAAGGAAGCAGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996385057 5:122902129-122902151 CCATGAGTACACAGGGAAGATGG - Intronic
997414345 5:133713608-133713630 CAGGGGGTATCCTGGGAAGATGG - Intergenic
997512368 5:134462399-134462421 CCCTGGGGAGCCAGGCAAGGAGG + Intergenic
998206089 5:140157677-140157699 CCCAGGAGACCCAGGGAAGACGG + Intergenic
1001092120 5:168749414-168749436 CCCTGGGAAGGCAAGGAAGATGG - Intronic
1002775007 6:321014-321036 CCCTGGGCACCCAGGGGAGGCGG + Intronic
1002917431 6:1540596-1540618 CCCTGGGTATGCAGAGCACAAGG + Intergenic
1003593093 6:7452444-7452466 CCATGGGTATCCAGGCTTGAGGG - Intergenic
1003934607 6:10962458-10962480 CCATGGGTATTAAGTGAAGATGG - Intronic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1005228510 6:23671630-23671652 GCCTGGGTACCCAGGCAAGAAGG - Intergenic
1005493367 6:26367824-26367846 ACCAGGGAATCCAGTGAAGAGGG + Intronic
1005502603 6:26443216-26443238 ACCAGGGAATCCAGTGAAGAGGG + Intronic
1006581258 6:35079063-35079085 TCCTGGCTCCCCAGGGAAGACGG - Intronic
1006799698 6:36752130-36752152 GCCTGGTTCTCCAGGGCAGAGGG - Intronic
1007370264 6:41422240-41422262 CCCTGGGGACCCAGGGATGCTGG - Intergenic
1007606158 6:43119587-43119609 CCCTGATCACCCAGGGAAGATGG - Intronic
1010341028 6:74752740-74752762 CACTGGGTGTTAAGGGAAGAAGG - Intergenic
1012004572 6:93696281-93696303 CTCTGAGTATCCATGAAAGAGGG - Intergenic
1013994827 6:116296083-116296105 CCCTTGGTATCCAGGGGAATTGG + Intronic
1019119630 6:169792723-169792745 CCCTGGGCATCCAGGGTGGAGGG + Intergenic
1019315163 7:380789-380811 CCCTGGCTCTCCCGGGGAGAGGG - Intergenic
1019364294 7:623912-623934 CCCTGTGGATCTAGGGAAGGAGG + Intronic
1019378384 7:708358-708380 CCCCTGGTATCCATGGGAGATGG + Intronic
1020505285 7:8979248-8979270 CCCTGAACAACCAGGGAAGATGG + Intergenic
1021041853 7:15872504-15872526 CCGTGGGTATCCAGGCTTGAGGG - Intergenic
1024086129 7:45893028-45893050 CCCTGGGTCTCCAGAGATCAGGG + Exonic
1026534359 7:71227967-71227989 CTATGCATATCCAGGGAAGAAGG - Intronic
1026849432 7:73715860-73715882 AGCTGGGTCTCCAGGAAAGACGG + Intronic
1029494068 7:100887890-100887912 CCCTGGGTAGTCAAGGAAGAGGG - Intronic
1030071100 7:105698199-105698221 CCCTGTGAATCCAGGTAACAGGG - Intronic
1030084976 7:105808135-105808157 CCCTGTGTGTCCTGGGGAGAAGG - Intronic
1030803031 7:113877754-113877776 TCCTGGCTATCCTGGGAAGAGGG - Exonic
1032079416 7:128851211-128851233 CCCTGGGGATACAGAGAAAAAGG - Exonic
1032197307 7:129796749-129796771 TCCTGGGTCATCAGGGAAGAGGG - Intergenic
1033227451 7:139572963-139572985 CAGTGGGTATCCAGTGTAGACGG + Exonic
1033360427 7:140635468-140635490 GCCTGGGGATCCCGGGAGGAGGG + Intronic
1033367983 7:140685687-140685709 GCCTGGATTTACAGGGAAGAGGG + Intronic
1034278298 7:149834002-149834024 TCCTGGGGCTCGAGGGAAGAGGG + Intergenic
1034474835 7:151276198-151276220 AGAGGGGTATCCAGGGAAGACGG + Intronic
1034784991 7:153917491-153917513 CCCTCAGTGGCCAGGGAAGAGGG - Intronic
1035438881 7:158879315-158879337 CCCTTGGTATCCATGGGAGAAGG + Intronic
1035692612 8:1570060-1570082 CCCTGTGTTTCCAGGAAACAAGG + Intronic
1037762201 8:21748978-21749000 TCCTGGGTGTCCAGGGGAGGAGG - Intronic
1037936576 8:22918864-22918886 CCAAGGGTTTCCAGGGAAGAGGG + Intronic
1038407906 8:27335676-27335698 CCCTGGGGGTCCCTGGAAGAGGG + Intronic
1039552510 8:38453294-38453316 CCCTGGGCCTCCAGGGGAGACGG - Intronic
1040279884 8:46034770-46034792 CCCTGGGCAACAAGGGAAGGAGG + Intergenic
1041467470 8:58171327-58171349 CAGTGGGTGTCCAGGGATGAAGG - Intronic
1042524215 8:69747669-69747691 CCCTTGGTATCCACGGGGGATGG - Intronic
1044413331 8:91909572-91909594 CCCTGAGTGGCTAGGGAAGATGG - Intergenic
1044763746 8:95549633-95549655 CCCTGGGTATCCATGGGAAGAGG + Intergenic
1045217036 8:100158534-100158556 CCCTGTGGATGCAGGAAAGAGGG + Exonic
1046138600 8:110061884-110061906 CCCTGAGTATTCACTGAAGAAGG + Intergenic
1046237498 8:111445791-111445813 CCCTGGGTGTCCATGGAGGATGG + Intergenic
1046423499 8:114015033-114015055 GCCTTGCTATCCAGGTAAGAGGG + Intergenic
1047942878 8:129843219-129843241 CTCTGGGTGTCCATGGGAGATGG - Intronic
1048196317 8:132334785-132334807 GCCTCAGTGTCCAGGGAAGAGGG - Intronic
1049043662 8:140131906-140131928 CCCTCGGTCCCCTGGGAAGAGGG - Intronic
1049057998 8:140254251-140254273 CCCTGTGTATCCTGGGCAGTGGG + Intronic
1049514168 8:143044655-143044677 CCCTGGGGTGCCAGGGCAGAGGG - Exonic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051185540 9:14457212-14457234 AACTGGATATCCAGGGAACAGGG + Intergenic
1051876382 9:21798348-21798370 TCCTGGGAGTCCAGGGTAGATGG + Intergenic
1052459697 9:28747029-28747051 CCCTGGGTTTCCAGGCTTGAAGG - Intergenic
1054872643 9:70062705-70062727 CCCTGGTGATCCAGTTAAGAAGG - Intronic
1056301841 9:85249895-85249917 CCATGGGTATCCAGGCTTGAGGG + Intergenic
1056852561 9:90096705-90096727 CCCTGGTTGAGCAGGGAAGAGGG + Intergenic
1056969145 9:91187943-91187965 CCCTGGGCAGCCCAGGAAGAAGG + Intergenic
1057810214 9:98251747-98251769 CCCTGGGTGTGCAGGCAGGAGGG + Intronic
1057973032 9:99575604-99575626 CCCTGGGTTTATATGGAAGAAGG + Intergenic
1058256861 9:102777658-102777680 CCATGGGTATCCAGGCTTGAGGG - Intergenic
1058477326 9:105350838-105350860 CCCTGGATACCCAAGAAAGATGG - Intronic
1059071269 9:111139018-111139040 CCCTGGGTATCCGGGGTGGGGGG - Intergenic
1059528888 9:115017809-115017831 CCCTGGCTATCAAGGGGAGGAGG + Intergenic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1062040830 9:134403556-134403578 CCCTGGGTGTCCAGGACAGGCGG - Intronic
1062148234 9:135002625-135002647 GCCTCAGTCTCCAGGGAAGAGGG - Intergenic
1062318619 9:135979834-135979856 CCCTGGGTGTCCCTGGAGGAAGG - Intergenic
1062324343 9:136005079-136005101 CCCTGGTTTTCCAAGGAGGAGGG - Intergenic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1062546679 9:137066702-137066724 CCCTGGGTCTCCAAGGCAGCTGG + Intronic
1203698063 Un_GL000214v1:115224-115246 GCCTGGGTACCCACGGATGAAGG + Intergenic
1203551141 Un_KI270743v1:165757-165779 GCCTGGGTACCCACGGATGAAGG - Intergenic
1185569729 X:1124339-1124361 CCCTGCGTTTGCAGCGAAGATGG - Intergenic
1185822589 X:3219556-3219578 CCTAGGGTGTCCAGGGCAGATGG - Intergenic
1187782434 X:22843036-22843058 GCCTTGGTTTCCAGGGAAAAGGG - Intergenic
1188658011 X:32722502-32722524 CCCTTGGTATCCACGGGACATGG - Intronic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1190571458 X:51786689-51786711 CCCTTGGTACCCAGAGAAGGAGG + Intergenic
1191611078 X:63114372-63114394 GCCTGGGCATACAGGGCAGAGGG - Intergenic
1192210883 X:69127040-69127062 CCCAGGCTATCCAAGGGAGAAGG + Intergenic
1192237640 X:69306081-69306103 CCCGGGGTGGCCAGGGAAGTCGG - Intergenic
1193975520 X:88113755-88113777 CCCTGGGTCTCCAGAAAAGCAGG + Intergenic
1194407972 X:93521277-93521299 CCCTCGGTATCCACAGAAGATGG + Intergenic
1194878436 X:99219470-99219492 CCCTGGGTATCCTGGGCAGTGGG + Intergenic
1196613694 X:117743226-117743248 TCCTGGGTATGAAGCGAAGAGGG - Intergenic
1198691733 X:139292203-139292225 CCCTGGTTGTGCATGGAAGAGGG + Intergenic
1200222445 X:154397799-154397821 CCCTGGGTCTCCAGGAAACGGGG + Intronic
1200760820 Y:7037212-7037234 CCCTGGGCATCCATGGGGGATGG + Intronic
1201152412 Y:11101360-11101382 GCCTGGGTACCCACGGATGAAGG - Intergenic
1201271275 Y:12257621-12257643 CACTGTGTATCCCGTGAAGATGG + Intergenic
1202199544 Y:22331772-22331794 GCCTGAGTCTCCAGGGAAGTTGG - Intronic
1202232215 Y:22669306-22669328 TCCTGAGTCTCCAGGGAAGATGG - Intergenic
1202310941 Y:23526852-23526874 TCCTGAGTCTCCAGGGAAGATGG + Intergenic
1202559861 Y:26143742-26143764 TCCTGAGTCTCCAGGGAAGATGG - Intergenic