ID: 1181956142

View in Genome Browser
Species Human (GRCh38)
Location 22:26589439-26589461
Sequence CGGAGTTTACGGAGGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 163}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181956136_1181956142 -5 Left 1181956136 22:26589421-26589443 CCAGCTCACACCGAGAAGCGGAG No data
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956131_1181956142 10 Left 1181956131 22:26589406-26589428 CCGGGCACCTCCCATCCAGCTCA 0: 1
1: 0
2: 3
3: 31
4: 381
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956130_1181956142 18 Left 1181956130 22:26589398-26589420 CCGGCTTTCCGGGCACCTCCCAT 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956134_1181956142 -1 Left 1181956134 22:26589417-26589439 CCATCCAGCTCACACCGAGAAGC No data
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956133_1181956142 0 Left 1181956133 22:26589416-26589438 CCCATCCAGCTCACACCGAGAAG No data
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956129_1181956142 19 Left 1181956129 22:26589397-26589419 CCCGGCTTTCCGGGCACCTCCCA 0: 1
1: 0
2: 3
3: 15
4: 212
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956127_1181956142 25 Left 1181956127 22:26589391-26589413 CCCAGTCCCGGCTTTCCGGGCAC No data
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956124_1181956142 30 Left 1181956124 22:26589386-26589408 CCAGTCCCAGTCCCGGCTTTCCG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956128_1181956142 24 Left 1181956128 22:26589392-26589414 CCAGTCCCGGCTTTCCGGGCACC No data
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163
1181956132_1181956142 3 Left 1181956132 22:26589413-26589435 CCTCCCATCCAGCTCACACCGAG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181956142 Original CRISPR CGGAGTTTACGGAGGGAGGT TGG Intronic
911339249 1:96617466-96617488 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913607737 1:120481241-120481263 TGGAGTCTACGGAGGCAGGCAGG - Intergenic
914997080 1:152553387-152553409 TGGAGTCTACAGAGGCAGGTAGG + Intronic
916032816 1:160893046-160893068 TGGAGTCTACGGAGGCAGGCAGG - Intergenic
917207886 1:172596887-172596909 CGGAGTCTACAGAGGCAGGCAGG + Intronic
919770294 1:201154241-201154263 CGGAGATGGCGGAGGGCGGTGGG - Exonic
920205282 1:204286747-204286769 GGGAGTGTAGGGATGGAGGTTGG + Intronic
921981435 1:221263089-221263111 TGGAGTTTACAGAGGCAGGCAGG + Intergenic
924864245 1:247960539-247960561 TGGAGTTTACAGAGGCAGGCAGG + Intronic
1064829479 10:19445897-19445919 TGGAGTCTACAGAGGCAGGTAGG + Intronic
1066417922 10:35238378-35238400 CGGATTTCACGGAGAGAGGCCGG + Intergenic
1067193373 10:44091421-44091443 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
1067955651 10:50788038-50788060 TGGAGTCTACAGAGGCAGGTAGG + Intronic
1068576218 10:58687469-58687491 TGGAGTCTACAGAGGGAGGCAGG + Intronic
1069188982 10:65464028-65464050 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
1070474048 10:76814810-76814832 TGGAGCTTACGGAGGCAGGCAGG + Intergenic
1073927383 10:108532975-108532997 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
1074000527 10:109367764-109367786 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1078357579 11:10643741-10643763 CGGAGCTTAGGGAGGGAGGGAGG - Intronic
1079174704 11:18128377-18128399 TGGAGTTTACAGAGGCAGGCAGG + Intronic
1080472002 11:32555319-32555341 AGCAGTTTAGGGAGGGTGGTTGG - Intergenic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1081768270 11:45628092-45628114 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1083003653 11:59321092-59321114 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
1087103203 11:94384741-94384763 TGGAGTCTACAGAGGGAGGCAGG - Intronic
1087517615 11:99183755-99183777 TGGAGTTTACGCAGTTAGGTTGG - Intronic
1093992867 12:25609951-25609973 TGGAGTTTACAAAGGCAGGTGGG + Intronic
1096585504 12:52617174-52617196 AGGAGTTTTCAGATGGAGGTGGG - Intronic
1098889185 12:75991488-75991510 GGGAGTTGAGGGAGGGAGGTGGG - Intergenic
1105420036 13:20243799-20243821 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1106640932 13:31584089-31584111 TGGAGTTTACAGAGGCAGGCAGG + Intergenic
1108988784 13:56629205-56629227 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
1109659157 13:65435916-65435938 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
1110699159 13:78526578-78526600 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1111416771 13:87956837-87956859 AGGAGATTAGGGAGGCAGGTAGG + Intergenic
1114579491 14:23744524-23744546 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1114581263 14:23762308-23762330 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1114691558 14:24587285-24587307 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1116711329 14:48371855-48371877 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1116727214 14:48575858-48575880 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1117349912 14:54870890-54870912 TGGAGTCTACGGAGGCAGGCAGG - Intronic
1117576699 14:57106089-57106111 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1118829935 14:69421610-69421632 TGGAGTCTACGGAGGCAGGCAGG + Intronic
1118971480 14:70641849-70641871 CGCAGGTTGCGGAGGGAGGAGGG + Exonic
1122737974 14:103854832-103854854 TGGAGGCTATGGAGGGAGGTAGG + Intergenic
1127165989 15:56244790-56244812 CGGAGTCTGCGGGGGGAGGGCGG - Intronic
1127189582 15:56515515-56515537 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1127456399 15:59159476-59159498 TGGAGTGTCAGGAGGGAGGTGGG + Intronic
1128339815 15:66813612-66813634 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
1129265583 15:74391615-74391637 AGGAGTGTACGGGGGCAGGTGGG - Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1133110214 16:3543548-3543570 CGGAGTATGCGGAGGGAGGTGGG - Intronic
1134901080 16:17938632-17938654 CACAGATTAAGGAGGGAGGTTGG - Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136675946 16:31906376-31906398 TGGAGTCTACGGAGGCAGGCAGG + Intronic
1137864269 16:51877068-51877090 GGGAGATTAAGGAGGCAGGTGGG + Intergenic
1142000889 16:87663741-87663763 GTAAGTTTACCGAGGGAGGTGGG - Intronic
1143491240 17:7286384-7286406 AGGTGTTGACGGAGTGAGGTGGG - Intronic
1143872869 17:9970111-9970133 CCGACTCTACGGAGGGAGATTGG - Intronic
1164248601 19:23457339-23457361 TGGAGTCTACGGAGGCAGGCAGG + Intergenic
1165079790 19:33300719-33300741 GGGTGTGTGCGGAGGGAGGTGGG + Exonic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
924995413 2:356270-356292 AGGAGTTCTCGGAGGGAGGAGGG + Intergenic
929284276 2:40117805-40117827 GGAAGTTTACGGAGGAAGGATGG - Intronic
933545937 2:83712272-83712294 CGGAATCAAAGGAGGGAGGTAGG - Intergenic
933631343 2:84662644-84662666 TGGAGTCTACAGAGGCAGGTAGG - Intronic
934531624 2:95093243-95093265 TGGAGTCTACAGAGGCAGGTGGG - Intronic
935716995 2:105947978-105948000 GGGAGTGTAGGGAGGGAGGAAGG + Intergenic
937048257 2:118864555-118864577 CTGAATTTATGGAGGGATGTAGG - Intergenic
941100208 2:161286693-161286715 TGGAGTTTACAGAGGCAGGCAGG - Intergenic
943652440 2:190471635-190471657 TGGAGTTTACTGAGGCAGGCAGG - Intronic
946200784 2:218069663-218069685 CGGAGGTAAATGAGGGAGGTGGG - Intronic
946524646 2:220505246-220505268 AGGAGTGTAAGGAGGGAGGAAGG + Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
1170494593 20:16913028-16913050 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1171352323 20:24512668-24512690 TGGAGTCTACAGAGGCAGGTAGG - Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1180598969 22:17001762-17001784 TGGAGTCTACAGAGGCAGGTAGG + Intronic
1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG + Intronic
1183483475 22:38077248-38077270 GGGAGTTTGCGGAGGGAAGGCGG + Intergenic
1184148595 22:42625688-42625710 CTGAGGTCACGGAGGAAGGTAGG + Intronic
1185289666 22:50017113-50017135 CGGAGTTTGCCGTGGGCGGTGGG - Intronic
949308703 3:2672213-2672235 TGGAGTCTACAGAGGCAGGTAGG + Intronic
951751581 3:26042220-26042242 TGGAGTCTACGGAGGCAGGCAGG + Intergenic
954827970 3:53391658-53391680 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
956820430 3:72949210-72949232 TGGAGTTTACAGTGGGAGGAGGG - Intronic
956993313 3:74794605-74794627 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959725653 3:109538713-109538735 TGGAGTTTACAGAGGCAGGCAGG - Intergenic
962678110 3:137771002-137771024 CGGTGATAACCGAGGGAGGTGGG + Intergenic
962699242 3:137980371-137980393 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
964100294 3:152980735-152980757 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
964463715 3:156966670-156966692 TGGAGTCTACGGAGGCAGGCAGG - Intronic
964500239 3:157340566-157340588 TGGAGTCTACAGAGGCAGGTAGG - Intronic
964715282 3:159714786-159714808 TGGAGTCTACAGAGGCAGGTGGG - Intronic
965731300 3:171774840-171774862 AGGAGTTCACTGAGGGAGGCTGG + Intronic
966807124 3:183816423-183816445 TGGAATTTACGGAGGAAGTTAGG + Exonic
970597737 4:17615296-17615318 TGGAGGTTAGGGAGGGAGGGAGG + Intronic
970972166 4:21997169-21997191 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
971414637 4:26413058-26413080 CGGATTTAACTGAGGGAGGAGGG - Intronic
973546737 4:51990005-51990027 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
977218817 4:94314738-94314760 TGGAGTCTACGGAGGCAGGCAGG + Intronic
977219773 4:94325389-94325411 TGGAGTCTACAGAGGCAGGTAGG + Intronic
977630674 4:99239216-99239238 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
978243182 4:106540707-106540729 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
989077207 5:37576140-37576162 TGGATTTTAGGGAGGGAGGGAGG - Intronic
990038273 5:51349199-51349221 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
991243429 5:64484606-64484628 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
992604402 5:78440808-78440830 TGGAGTCTACGGAGGCAGGCAGG + Intronic
995073032 5:107947072-107947094 TGGAGTTTACTGAGAGACGTAGG - Intronic
996477896 5:123941906-123941928 TGGAGTTTACAGAGGCAGGCAGG - Intergenic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1004831568 6:19482266-19482288 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1005558167 6:27008923-27008945 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1008281279 6:49599084-49599106 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1010105621 6:72163990-72164012 TGGAGTTTACAGAGGCAGGCAGG + Intronic
1012129411 6:95471942-95471964 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1013258269 6:108411302-108411324 TGGAGTCTACAGAGGCAGGTAGG - Intronic
1013385311 6:109623914-109623936 GGGGGCTTACGGAGGGATGTGGG - Intronic
1013998990 6:116343186-116343208 TGGAGTCTACAGAGGCAGGTAGG - Intronic
1014501458 6:122195209-122195231 CAGAGTTTCCGGAGGGAGTGTGG + Intergenic
1014842877 6:126240808-126240830 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1016827424 6:148401147-148401169 CGGAGGTTAAGGTGGGAGGATGG + Intronic
1017715278 6:157206676-157206698 CGGAGCTTAAGGGGGGAGGTGGG - Exonic
1020344147 7:7145225-7145247 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1021307206 7:19046250-19046272 TGGAGTCTACAGAGGCAGGTGGG - Intronic
1023866575 7:44241267-44241289 GGGAGTTCTGGGAGGGAGGTGGG - Intronic
1024656819 7:51458053-51458075 CGGAGTTTAGGGTGGGAGTCGGG - Intergenic
1028065231 7:86375896-86375918 TGGAGTTTACAGAGGCAGGCAGG - Intergenic
1029808058 7:103016867-103016889 TGGAGTCTACAGAGGCAGGTAGG - Intronic
1030817535 7:114055460-114055482 TGGAGTCTACAGAGGCAGGTAGG - Intronic
1035558812 8:589669-589691 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1040410916 8:47153293-47153315 TGGAGTTTACAGAGGCAGGCAGG - Intergenic
1040608523 8:48959484-48959506 TGGAGTTTACAGAGGCAGGCAGG + Intergenic
1041665897 8:60444586-60444608 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1042763072 8:72291573-72291595 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1044042321 8:87385659-87385681 TGGAGTCTACAGAGGCAGGTAGG - Intronic
1044183547 8:89224203-89224225 TGGAGTTGGGGGAGGGAGGTGGG + Intergenic
1044440820 8:92221664-92221686 TGGAGTTTACAGAGGCAGGCAGG + Intergenic
1049484861 8:142850463-142850485 TGGAGTCTACAGAGGCAGGTGGG - Intronic
1049570492 8:143368188-143368210 CGGAGGTTCTGGAGGGAGGCGGG + Intergenic
1050011154 9:1187188-1187210 TGGAGTCTACGGAGGCAGGCAGG + Intergenic
1050034837 9:1424344-1424366 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1051381096 9:16459426-16459448 AGGATTTTACTGAGGGTGGTGGG + Intronic
1052696803 9:31888749-31888771 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1055053191 9:72000104-72000126 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
1057259279 9:93575404-93575426 CGGATTTTGCTGAGGGAGGATGG + Intergenic
1057698120 9:97341788-97341810 TGGAGTCTACAGAGGCAGGTGGG + Intronic
1058962532 9:110005625-110005647 TGGAGTTTACAGAGGCAGGCAGG + Intronic
1188679128 X:32979896-32979918 CGTAATTTAGGGAGGGAGGTTGG + Intronic
1190984773 X:55490184-55490206 GGGAGTTGACGGAGGGAGGGAGG + Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1196626618 X:117884465-117884487 AGGAGCTGACGGGGGGAGGTTGG + Intergenic
1196853590 X:119961995-119962017 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1196863746 X:120051969-120051991 TGGAGTCTACAGAGGCAGGTGGG + Intergenic
1196879353 X:120184361-120184383 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
1198858538 X:141044821-141044843 TGGAGTCTACAGAGGCAGGTAGG - Intergenic
1198904159 X:141542567-141542589 TGGAGTCTACAGAGGCAGGTAGG + Intergenic
1199449926 X:147967936-147967958 TGGAGTCTACAGAGGCAGGTGGG - Intergenic
1199484227 X:148331060-148331082 TGGAGTCTACGGAGGCAGGCAGG + Intergenic
1200805428 Y:7428510-7428532 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1201590695 Y:15611414-15611436 TGGAGTTTACAGAGGCAGGCAGG - Intergenic
1202331383 Y:23756808-23756830 TGGAGTCTACGGAGGCAGGCAGG - Intergenic
1202539387 Y:25913252-25913274 TGGAGTCTACGGAGGCAGGCAGG + Intergenic