ID: 1181957921

View in Genome Browser
Species Human (GRCh38)
Location 22:26601747-26601769
Sequence CAGCACTGGGAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 1, 2: 11, 3: 147, 4: 783}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181957911_1181957921 15 Left 1181957911 22:26601709-26601731 CCCAGAGGAATAGAGCTCTGTTG 0: 1
1: 0
2: 0
3: 21
4: 186
Right 1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG 0: 1
1: 1
2: 11
3: 147
4: 783
1181957910_1181957921 16 Left 1181957910 22:26601708-26601730 CCCCAGAGGAATAGAGCTCTGTT 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG 0: 1
1: 1
2: 11
3: 147
4: 783
1181957912_1181957921 14 Left 1181957912 22:26601710-26601732 CCAGAGGAATAGAGCTCTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG 0: 1
1: 1
2: 11
3: 147
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181957921 Original CRISPR CAGCACTGGGAGACTGTGGA AGG Intronic
900405644 1:2491839-2491861 CAGCACTGTCACCCTGTGGAGGG - Intronic
900405685 1:2492004-2492026 CAGCACTGTCACCCTGTGGAGGG - Intronic
900932231 1:5744439-5744461 CAGCACTGGGAGCTCCTGGAAGG - Intergenic
901175288 1:7294280-7294302 CAGGACTGGGGGGCTATGGATGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901606175 1:10461154-10461176 CAGCACTGGGAGGCCGAGGGGGG - Exonic
901847743 1:11994993-11995015 CAGCACTGGGAGGCTGAGGCAGG + Intronic
902314620 1:15608764-15608786 CAGCACTGTGAGACTGAGGTGGG - Intergenic
902705459 1:18201191-18201213 CAGCCCTGGGAGACTGAGTCAGG + Intronic
902826317 1:18976747-18976769 CAGCACTGCGAGGCTGAGGCAGG + Intergenic
902848584 1:19133699-19133721 CAACACTGGGAGGCTGAGGCAGG + Intronic
902922067 1:19672035-19672057 CATCCTTGGGAGATTGTGGAGGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903262042 1:22136662-22136684 CAGCTCTGGGAGACCTGGGATGG + Intronic
903333386 1:22608939-22608961 CAGCACTGGGCAGCTGGGGAAGG + Intergenic
903533866 1:24053512-24053534 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
903563291 1:24245455-24245477 CAACACTGGGAGGCTGAGGCAGG - Intergenic
903847732 1:26288469-26288491 CAGCACTGAGAGAATGAGGTGGG + Intronic
903883489 1:26528389-26528411 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
903924199 1:26819864-26819886 CAGCACTTGGAGGCTGAGGCGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904700449 1:32354850-32354872 CAGCACTGGGAGGCCGAGGAGGG - Intronic
904742938 1:32692498-32692520 CAACACTGGGAGGCTGAGGCCGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905160661 1:36030725-36030747 CAGCATTGGGAGGCTGAGGCGGG - Intronic
905187295 1:36205602-36205624 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
905393936 1:37655468-37655490 CAGCTCTGGGAGCCAGAGGAAGG + Intergenic
905751585 1:40469429-40469451 CAACACTGGGAGGCTGAGGCAGG + Intergenic
906317370 1:44796816-44796838 CAGCACTGGGAGGCCGAGGCCGG - Intergenic
906325378 1:44842523-44842545 CAACACTGGGAGGCTGAGGCAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906467747 1:46098946-46098968 CAGCTCTGGGAGACTGAGGTGGG - Intronic
906472812 1:46145254-46145276 CTGCACTGTGAGACTGTCAAGGG + Intronic
906625886 1:47325260-47325282 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
906692199 1:47799860-47799882 AAGCATTTGGAGCCTGTGGAAGG - Intronic
906712948 1:47945175-47945197 CAGCACTTGGAGATAGTGAAAGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906811979 1:48836349-48836371 CAGCACTGGAAGACCTTTGAAGG - Intronic
908125529 1:61026471-61026493 CAACACTGGGAGACTGAGGCGGG + Intronic
908205454 1:61843489-61843511 CAACACTGGGAGGCTGAGGCAGG + Intronic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908696959 1:66854553-66854575 CAGCACTGGGAGGCGGAGGCAGG + Intronic
908708543 1:66989709-66989731 CAACACTGGGAGGCTGAGGCGGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910507051 1:87961212-87961234 TAGCCCTGGGAGACAGAGGAGGG - Intergenic
910509374 1:87986404-87986426 TGGCACTGTGAGACTTTGGATGG + Intergenic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
910689109 1:89948006-89948028 CAGCATTGGGAGGCTGAGGCGGG - Intergenic
911317125 1:96369183-96369205 CAGCACTGGGAGACTGAGGCAGG + Intergenic
911680154 1:100705984-100706006 CATCACTGGGAGAGTATGTAGGG - Intergenic
911780376 1:101869044-101869066 CACTGCTGGGACACTGTGGAAGG + Intronic
912343041 1:108936341-108936363 CAGCACTGGGAGGCCGAGGCAGG - Intronic
912451081 1:109768192-109768214 CAGAGCTGGGAAACTCTGGAGGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913565896 1:120071598-120071620 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
913583559 1:120250766-120250788 CTACACAGTGAGACTGTGGAGGG - Intergenic
913624617 1:120647554-120647576 CTACACAGTGAGACTGTGGAGGG + Intergenic
913632237 1:120721955-120721977 CGGCAGTGGAAGACAGTGGAGGG + Intergenic
914286482 1:146230962-146230984 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
914547513 1:148681704-148681726 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
914565547 1:148862602-148862624 CTACACAGTGAGACTGTGGAGGG - Intronic
914607278 1:149267650-149267672 CTACACAGTGAGACTGTGGAGGG + Intergenic
914618999 1:149388649-149388671 CGGCAGTGGAAGACAGTGGAGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915027732 1:152848090-152848112 CTGCCTTGTGAGACTGTGGAGGG + Intergenic
915175670 1:154012755-154012777 CAGCACTGGGAGGCCGAGGCGGG + Intronic
915490755 1:156248852-156248874 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
916413372 1:164569805-164569827 CAGCACTGGGAGGCCGAGGCAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917386052 1:174475657-174475679 CAGCTCTGGGAGGCTGAGGTGGG + Intronic
917633228 1:176910322-176910344 AAGCCCTGGGAGACTGAGGACGG - Intronic
920446226 1:206020825-206020847 CAGCACAGGGGGACTCTGGCAGG - Intronic
921257149 1:213352791-213352813 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
921527979 1:216241778-216241800 CAGCACTGAGAGGCTGAGGCGGG - Intronic
921724825 1:218512137-218512159 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
921726793 1:218533243-218533265 CAGCACTGGGAGGCTGAGGTGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922531687 1:226349927-226349949 CAACACTGGGAGGCTGAGGCAGG - Intergenic
922740113 1:228009796-228009818 CAGCCCTGTGAGAGTGTGAAGGG + Intronic
923447048 1:234081508-234081530 CAGCAGTGGGTCACTGTGGATGG + Intronic
923459345 1:234195160-234195182 AAGAAATGGGAGACAGTGGAAGG - Intronic
923518870 1:234720792-234720814 CAGGACAGGGTAACTGTGGAAGG - Intergenic
923606014 1:235443447-235443469 CAACACTGGGAGGCTGAGGCAGG - Intronic
923615607 1:235534570-235534592 CAGGACTGGGAGGCTGAGGCGGG + Intergenic
924025206 1:239825051-239825073 CAGCACTGGGTTACAGTGGTGGG + Intronic
924489888 1:244526159-244526181 CAGCATTGGGAGGCTGAGGTGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063183659 10:3630962-3630984 CAGCATTGAGAGACTATTGAAGG + Intergenic
1063449590 10:6142604-6142626 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1063555598 10:7076074-7076096 CAGCACTGGGAGATGGTGTACGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064325037 10:14341898-14341920 CAGCACTGGGAGACTGAGGCAGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1065126817 10:22581863-22581885 CAGCACTGGGAGGTTGAGGCAGG + Intronic
1065154212 10:22853036-22853058 AGGCACTGAGAGACTGAGGATGG + Intergenic
1065679693 10:28216129-28216151 CAACACTGGGAGGCTGAGGCAGG + Intronic
1065983624 10:30928713-30928735 CAGGACTCGGGGACAGTGGAGGG - Intronic
1066051658 10:31642239-31642261 TAGCACTTGGAGGCTCTGGAAGG + Intergenic
1066624966 10:37396923-37396945 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1066967728 10:42284874-42284896 CAGCACTGGGAGATAGTCCATGG - Intergenic
1067955949 10:50790780-50790802 CAGCACTGGGAAACTTTCCAGGG - Intronic
1068007687 10:51409606-51409628 CAACACGGGGAGGCTGAGGAGGG + Intronic
1068108491 10:52650509-52650531 AAGCACTGGATGACTGTTGAGGG + Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068536843 10:58249330-58249352 CAGCCCTGGGAGGCTGGGGTGGG - Intronic
1068890389 10:62142582-62142604 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069001951 10:63276707-63276729 CAGCACTGGGAGGTTGAGGAGGG - Intronic
1069378978 10:67822739-67822761 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1069380533 10:67839680-67839702 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1069667593 10:70173853-70173875 CAACACTGGGAGACCGAGGCAGG + Intergenic
1069829392 10:71273327-71273349 CAGCACTGTGAGACCTTGGGAGG - Intronic
1070895669 10:79981735-79981757 CAGCCCTGGGAGCCGGAGGATGG + Intronic
1071184412 10:83024507-83024529 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1071353617 10:84770985-84771007 CAGCAAGGGGACACTGTGGTTGG + Intergenic
1071450908 10:85790754-85790776 CAGCAGTGGCTGACTGTGCAGGG + Intronic
1072162600 10:92782333-92782355 CAGCACTGGGAGGCTGAGGCCGG + Intergenic
1072313912 10:94183483-94183505 CAGCACTGGGTGAGGGGGGAAGG - Intronic
1072574918 10:96690682-96690704 CACCACTTGGTGAATGTGGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072617712 10:97060455-97060477 CAGGGCTGGGAAACTCTGGAGGG - Intronic
1072974915 10:100049203-100049225 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1073567795 10:104550215-104550237 TAGCACTGGGAGGCTGAGGTGGG - Intergenic
1073759814 10:106617199-106617221 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1074010329 10:109472301-109472323 CAGCACTCTGAGGCTATGGATGG - Intergenic
1074042970 10:109810419-109810441 CAGCATTGGGAGGCTGAGGAGGG + Intergenic
1074518671 10:114197092-114197114 CAACACTGGGAGGCTGAGGCAGG - Intronic
1074653611 10:115557057-115557079 CAGAGCTGGGAAACTGTAGAAGG + Intronic
1076484772 10:130808880-130808902 CAGCCCTGGAGGGCTGTGGAGGG - Intergenic
1076826215 10:132970959-132970981 CAGCACTGGGGGACTGACCAGGG + Intergenic
1077180165 11:1208665-1208687 CAGCACCGGGCCACTGGGGAAGG + Intergenic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1077537787 11:3132748-3132770 TAGCACTGGGAGTCCTTGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078216717 11:9318007-9318029 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1078258771 11:9684326-9684348 CAACACTGGGAGGCTGAGGCAGG - Intronic
1078275383 11:9839986-9840008 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1078481614 11:11681174-11681196 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1078544938 11:12240595-12240617 CAGCACTTGGGGACTGTGAGGGG - Intronic
1078934912 11:15941712-15941734 CAGCACAGGGAGCCTGGGCAAGG + Intergenic
1079219404 11:18546743-18546765 CAACACTGGGAGTCTGAGGCGGG - Intronic
1079661607 11:23043996-23044018 CAACACTGGGAGGCTGAGGCAGG + Intergenic
1080565304 11:33504011-33504033 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1080650553 11:34219429-34219451 CAGCTGTGGGAGGCTGAGGAGGG + Intronic
1080827270 11:35858938-35858960 CAGCATGGGGAACCTGTGGAAGG - Intergenic
1080883123 11:36341154-36341176 CAGCACAGGGAGGCTCAGGAAGG - Intronic
1081060424 11:38468104-38468126 CAAAACTGGGAGGCTGAGGAGGG + Intergenic
1081965375 11:47166108-47166130 CAGCACTGGGAGGCTGAGATGGG - Intronic
1083211490 11:61190104-61190126 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
1083626174 11:64073162-64073184 CAGCCCTGGGAGTCTGTGCCTGG - Intronic
1084102242 11:66957502-66957524 CAGCACTGGGGGACTGTGGCAGG + Intronic
1084117699 11:67051600-67051622 CAGCACTCGCTGAATGTGGAAGG - Intergenic
1084248632 11:67878400-67878422 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1084598218 11:70129867-70129889 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1084965279 11:72741340-72741362 GAGGACTGGGAGAGTGGGGAGGG - Intronic
1084969674 11:72764261-72764283 CTGCTCTGGGAGCCTCTGGAAGG - Intronic
1085001629 11:73042171-73042193 CAACACTGGGAGGCTGAGGTGGG - Intronic
1085109603 11:73876015-73876037 CAACACTGGGAGGCTGAGGCGGG + Intronic
1085351964 11:75803354-75803376 CAGCACTTTGAGACTGAAGATGG + Intergenic
1085354915 11:75827361-75827383 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085796484 11:79545235-79545257 CAGATCTGGGTGACTGTGGGAGG + Intergenic
1086051536 11:82597458-82597480 CAGTAATGGGAGAGAGTGGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087932952 11:103999595-103999617 CAGCACTGGGAGATGATGGTTGG - Intronic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088259012 11:107927685-107927707 CAGCACTGGGAGGCTGAGCCTGG + Intronic
1088270342 11:108027653-108027675 CAACACTGGGAGGCTGAGGCGGG - Intronic
1088858527 11:113778534-113778556 CAGCAAGGGGAGCCTGGGGAGGG + Intergenic
1089561344 11:119344809-119344831 CAGGACTGGGAGTGGGTGGAGGG + Intronic
1089713777 11:120336661-120336683 CAGCACCGGGAGCCTGGTGAGGG + Intergenic
1090116522 11:123979489-123979511 CAGCACTGGCAGAGGGTGGGAGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091530490 12:1350273-1350295 CAGCACTGAGACACAGTGGTGGG + Intronic
1091751621 12:3025188-3025210 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1092089976 12:5796648-5796670 CTGCACTGTGAGACTGCTGATGG - Intronic
1092095201 12:5836554-5836576 GAGCAGTGGGTGACTGTTGAAGG - Intronic
1092384896 12:8028538-8028560 CAACACTGGGAGTCTGAGGCGGG - Intergenic
1092396371 12:8130626-8130648 CAGCACGGGGAGGCTGAGGTGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092463142 12:8704133-8704155 CAACACTGGGAGGCTGAGGCAGG + Intronic
1092777928 12:11960294-11960316 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093400639 12:18742509-18742531 CAGCACTGGGAATCTGCGGTGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094621190 12:32082040-32082062 CAGCACTGGAAGGCTGAGGTGGG - Intergenic
1094684833 12:32701026-32701048 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096402450 12:51318506-51318528 CAACACTGGGAGGCTGAGGTGGG - Intronic
1096587237 12:52630650-52630672 CAGCAGTGGTAGCCTTTGGAGGG - Intergenic
1096725098 12:53555071-53555093 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096867029 12:54570743-54570765 CAGAACTGGGGGACGGGGGAGGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098977399 12:76917497-76917519 AAGCACTGGGAGGCTGAGGCGGG - Intergenic
1099612943 12:84898091-84898113 CAGCACTGGGAGGCTGAGATGGG + Intronic
1099639142 12:85262034-85262056 CAGCACTGGGAGACCAAGGCTGG - Intronic
1101001828 12:100364533-100364555 TAGCACTGGGTGGCTGAGGACGG + Intronic
1101230186 12:102732758-102732780 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1101520303 12:105475995-105476017 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1101610494 12:106287023-106287045 CAACACTGGGAGGCTGAGGTGGG + Intronic
1101674968 12:106909207-106909229 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1101957281 12:109222700-109222722 CAGCACGGTGGGACTGTGCATGG - Intronic
1101963255 12:109265434-109265456 CAGCACTGGCAGGCAGGGGATGG + Exonic
1102020748 12:109680556-109680578 AAGAACTGGTAGAATGTGGATGG - Intergenic
1102110450 12:110361541-110361563 CAGCACTGGCAGGCTGAGGTGGG + Intergenic
1102275778 12:111580890-111580912 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1102474854 12:113181903-113181925 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1102479229 12:113209630-113209652 CAGCACTGGGAGGCTAAGGTGGG - Intronic
1102493855 12:113305810-113305832 CAGCACTTGGAGGCTGAGGCTGG + Intronic
1102794252 12:115674746-115674768 CAGCTCTGGGAAGCTGTTGAGGG - Intergenic
1103173791 12:118844353-118844375 CAGCTCTGTGAGGCTGTGGCTGG - Intergenic
1103293243 12:119864580-119864602 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1103346635 12:120255447-120255469 CAGCACTGGGAGACCGAGGCAGG + Intronic
1103525636 12:121566240-121566262 CAACACTGGGAGGCTGAGGCGGG + Intronic
1103529027 12:121587312-121587334 CAACACTGGGAGGCTGAGGCAGG + Intergenic
1103635561 12:122302346-122302368 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1103637141 12:122316454-122316476 CATCACTGGGAGGCTGAGGTGGG - Intronic
1103766702 12:123285358-123285380 CAACACTGGAAGACTGAGGCGGG - Intergenic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1103979951 12:124730571-124730593 CAGCACTGGGAGAATTCAGAGGG - Intergenic
1104137188 12:125951836-125951858 CAACACTGGGAGGCTGTGGCAGG - Intergenic
1104975957 12:132552086-132552108 CAGAACATGGAGGCTGTGGATGG - Intronic
1105355623 13:19656873-19656895 TAATCCTGGGAGACTGTGGAGGG + Intronic
1105914418 13:24899855-24899877 CAACACTGGGAGGCTGAGGCAGG + Intronic
1106569495 13:30914258-30914280 CATAACTGGGAGGCTGGGGATGG + Intronic
1107004872 13:35598225-35598247 CAGAAGGGGGAGAATGTGGAAGG + Intronic
1107368386 13:39712104-39712126 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1107858457 13:44638160-44638182 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1107881346 13:44834519-44834541 AAGCACCTGGAGAGTGTGGAGGG - Intergenic
1108319195 13:49271163-49271185 CAGCACTGGGAGACTGAGGCAGG + Intronic
1108474591 13:50801294-50801316 CTGCACTGGGAGCAGGTGGATGG - Intronic
1108893079 13:55286849-55286871 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1109110710 13:58316181-58316203 CAGCACTGGGAGTTTCTTGAAGG - Intergenic
1110774941 13:79396931-79396953 TAGCACTGGGAGGCTGAGGCAGG + Intronic
1110959694 13:81606273-81606295 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1111255238 13:85659207-85659229 CATCACTGGGATGCTCTGGAAGG - Intergenic
1112096767 13:96141572-96141594 CAACACTGGGAGGCTGAGGCAGG - Intronic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113308609 13:109106724-109106746 CAGCACTGGGAGAGTCGAGAGGG + Intronic
1113448737 13:110390441-110390463 CAGCGCTGGGAGTCTGTGGGTGG + Intronic
1113598872 13:111554386-111554408 CAGTGCTGGGCGACAGTGGACGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113855522 13:113443359-113443381 CAGCACTTGGAGACTGAGGTGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114465026 14:22915740-22915762 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117124440 14:52606548-52606570 CAGCCCTGGGAGTCTGAGGTGGG - Intronic
1117698908 14:58394465-58394487 CAGCACTGGGAGACCGAGGTGGG - Intergenic
1117850676 14:59965635-59965657 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1118169181 14:63369331-63369353 CATTACTGGGAGACTGGGGGTGG - Intergenic
1118355839 14:65012988-65013010 CAGGACTGGGTGACGGTGGAGGG + Intronic
1118590745 14:67399113-67399135 TAGCACTGGGAGACTGTAAGTGG - Intronic
1119148956 14:72340733-72340755 GAGCTCTGGGAGACTGTGAAAGG + Intronic
1119208181 14:72810199-72810221 CAGCACTGGGATGTTGTGGGAGG - Intronic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1120788783 14:88560620-88560642 CTGCACTGGGATACAGTGGTAGG - Intergenic
1120833469 14:89018947-89018969 GAGCTTTGGGAGACTGAGGAGGG - Intergenic
1121756375 14:96406163-96406185 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1122397778 14:101446585-101446607 CAGGATTGGGAGGCTCTGGAAGG + Intergenic
1122413349 14:101537129-101537151 CATGACTGGGATTCTGTGGAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123144113 14:106111343-106111365 CACCACTGAGAGCCTGTGGATGG + Intergenic
1123220886 14:106854432-106854454 CACCACTGAGAGCCTGTGGATGG + Intergenic
1123410740 15:20056775-20056797 CAGCTCTAGCACACTGTGGAGGG - Intergenic
1123460160 15:20462573-20462595 CAACCCTGGGAGACAGTGGGAGG - Intergenic
1123520069 15:21063481-21063503 CAGCTCTAGCACACTGTGGAGGG - Intergenic
1123657902 15:22537844-22537866 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1123694190 15:22865106-22865128 CAGCACTGGGAGGCCGAGGATGG - Intronic
1123975851 15:25553914-25553936 CAGCACTGGGAAGCTGAGGTGGG + Intergenic
1124266383 15:28238344-28238366 CAACCCTGGGAGACAGTAGAAGG - Intronic
1124311813 15:28633043-28633065 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1124953423 15:34343974-34343996 CAACACTGGGAGGCTGAGGCAGG + Intronic
1125199674 15:37091884-37091906 CATTATTGGGAGACTGGGGAGGG - Intronic
1125669148 15:41457285-41457307 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127201333 15:56655451-56655473 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1127207923 15:56739675-56739697 CACCACTGGGGGACTTTGCAGGG + Intronic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127387834 15:58481554-58481576 CAGCACTTTGAGACTGAGGCAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128115820 15:65104627-65104649 CAGCACTGGGAGGCCGAGGCCGG + Intronic
1128235434 15:66064119-66064141 CAGCACTTGGAGGCTAAGGAAGG + Intronic
1128370544 15:67036035-67036057 CAGCCTGGGGAGACTGTGGCTGG - Intergenic
1128510933 15:68313652-68313674 CAGCACTAAGGGACTATGGATGG - Intronic
1128937314 15:71757884-71757906 GAGCACTGTGAGACAGGGGAAGG - Exonic
1129227773 15:74179910-74179932 CTGCACTGGGAGCCTCAGGAGGG - Intronic
1129882363 15:79015892-79015914 CAACACTTGGATGCTGTGGATGG + Intronic
1129960768 15:79682053-79682075 CAGCACTGGGGGATGGTGGCTGG + Intergenic
1131201991 15:90406409-90406431 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1131264973 15:90910430-90910452 CTGCACTGGCAGAGTGTGGGTGG + Intronic
1132230029 15:100175035-100175057 CAGGACTGGGAGATGCTGGAAGG - Intronic
1132405863 15:101541581-101541603 CAGCACTGGGACTCTGATGAGGG + Intergenic
1132757353 16:1492418-1492440 CAGCACTGGGAAGCTGAGGTGGG - Intergenic
1132759841 16:1503317-1503339 CAGCACTGGAAGGCTGAGGCGGG + Intronic
1132792989 16:1703802-1703824 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1132827039 16:1910273-1910295 CAGCCCTGGGAGGCTGGGCAGGG - Intergenic
1132912317 16:2320643-2320665 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1132952935 16:2574827-2574849 CAGATCTGGGGGACTGTGGGTGG + Intronic
1132961416 16:2625341-2625363 CAGATCTGGGGGACTGTGGGTGG - Intergenic
1134150514 16:11801105-11801127 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1134167204 16:11940490-11940512 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134255036 16:12603496-12603518 CAGCACTGGGGGTCTGTGGGAGG + Intergenic
1134493502 16:14713223-14713245 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134498883 16:14752347-14752369 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134525435 16:14938968-14938990 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134546970 16:15117410-15117432 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134547455 16:15121894-15121916 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134557536 16:15178603-15178625 GAACACTGGGAGTCTGTGCATGG - Intergenic
1134581685 16:15376668-15376690 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134713020 16:16337454-16337476 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1134720889 16:16380814-16380836 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134816552 16:17210656-17210678 CAGCACTGGGAGGCTGAAGGGGG - Intronic
1134918104 16:18090286-18090308 GAACACTGGGAGTCTGTGCATGG - Intergenic
1134946538 16:18331071-18331093 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134953799 16:18371218-18371240 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1135283380 16:21172197-21172219 CAACACTGGGAGGCTGAGGAGGG + Intronic
1135292044 16:21248269-21248291 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1135312599 16:21417949-21417971 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135332558 16:21572976-21572998 CAGCACTGGAAGGCTGAGGTGGG + Intergenic
1135365547 16:21850402-21850424 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135446292 16:22520934-22520956 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1136151776 16:28355898-28355920 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1136194966 16:28645273-28645295 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136211305 16:28759385-28759407 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136226049 16:28861375-28861397 CAACACTGGGAGGCTGAGGCGGG - Intronic
1136241448 16:28946974-28946996 CAGCACTGGGAGCCTGAGGTGGG - Intergenic
1136256026 16:29039335-29039357 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136309301 16:29396901-29396923 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136322719 16:29498457-29498479 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136437401 16:30238425-30238447 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136682838 16:31977984-31978006 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1136704576 16:32175757-32175779 CAACCCTGGGAGACAGTGGGAGG - Intergenic
1136733819 16:32444389-32444411 CAGCACTGGGAGATAGTCCATGG - Intergenic
1136763337 16:32753649-32753671 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1136783476 16:32921550-32921572 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1136804763 16:33116737-33116759 CAACCCTGGGAGACAGTGGGAGG - Intergenic
1136886312 16:33932299-33932321 CAAAACTGGGAGACAGTGGAGGG - Intergenic
1137294788 16:47080352-47080374 CAACACTGGGACACTGTGTGGGG + Exonic
1137605449 16:49783713-49783735 AGGCACTGGGAGCCTTTGGAAGG + Intronic
1138621185 16:58212624-58212646 CAGCACTTGGAGGCTGAGGTGGG + Intergenic
1139047165 16:63076001-63076023 CAGTACAGGGAGACTGTCTAGGG + Intergenic
1139268389 16:65660378-65660400 CAGCACTGAAAGCCTGGGGAAGG - Intergenic
1139524469 16:67505769-67505791 CAACGCTGGGAGACTGAGGTGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139632407 16:68238547-68238569 CAGCACTGGGAGACCGAGGCGGG - Intergenic
1139677883 16:68537803-68537825 TAGCACAGGGAGGCTGAGGAGGG - Intronic
1139825489 16:69754049-69754071 CAGCACTGGGAGACCGAGGCGGG - Intronic
1139856995 16:69989319-69989341 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140045304 16:71436699-71436721 CAACAGTGGGTGACTGTGGGAGG + Intergenic
1140356062 16:74307688-74307710 CAACACTGGGAGGCTGAGGCAGG + Intergenic
1140365716 16:74378656-74378678 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1141597338 16:85105358-85105380 CAGCTGGAGGAGACTGTGGATGG - Exonic
1141685569 16:85567968-85567990 CACCACTGGGAGGCTGGGGCAGG - Intergenic
1141793715 16:86254280-86254302 CAGCACCGGGAGGCTGAGGAGGG - Intergenic
1141835182 16:86533894-86533916 CAGCACTGGGAGACAGAGCCAGG - Intronic
1142000114 16:87659473-87659495 CAGCACTGGGAGGTTGAGGTGGG + Intronic
1203065487 16_KI270728v1_random:1013970-1013992 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1203086126 16_KI270728v1_random:1185534-1185556 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1142514092 17:415749-415771 CAACACTGGGAGGCTGGGGCAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142983264 17:3683482-3683504 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1143098234 17:4489899-4489921 CAGCTCTGGGAGGCTGAGGTGGG + Intergenic
1143167786 17:4906604-4906626 CATCACTGGGAGGCTGAGGTAGG + Intergenic
1143188691 17:5025567-5025589 CAGCACTGGGAGGCCGAGGCAGG + Exonic
1143449308 17:7026477-7026499 CAGAACTGTGAGGCTGTGGCAGG + Exonic
1143642840 17:8209257-8209279 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1143969591 17:10785907-10785929 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1144063722 17:11605749-11605771 CAGCACTGAGAGGCTGAGGAGGG - Intronic
1144171234 17:12661844-12661866 CAACACTGGGAGGCCGAGGAGGG + Intergenic
1144203242 17:12960319-12960341 CAACACTGGGAGGCTGAGGTGGG + Intronic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144544975 17:16185823-16185845 CAGGACTGGGAGACTAAGGTGGG + Intronic
1144612048 17:16728734-16728756 CAGAAGTGGGAGAGTGTGGGAGG - Intronic
1144900687 17:18586650-18586672 CAGAAGTGGGAGAGTGTGGGAGG + Intergenic
1144992625 17:19244210-19244232 CAGCACTGGGAGGCTGAGGCTGG + Intronic
1145131766 17:20359089-20359111 CAGAAGTGGGAGAGTGTGGGAGG - Intergenic
1145856693 17:28165966-28165988 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146334943 17:31961298-31961320 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146529047 17:33592250-33592272 CAGCACTGGGACACAGAGCAGGG - Intronic
1147143748 17:38473743-38473765 CAAAACTGGGAGACAGTGGAGGG + Intronic
1147154710 17:38538170-38538192 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1147227637 17:38992079-38992101 CAGCAGTGTGAGAATATGGAGGG + Intergenic
1147239369 17:39080493-39080515 AAGCTCTGGGAGGCTGTGAAAGG + Intronic
1147453385 17:40519821-40519843 CAGCACTCTCAGACTTTGGATGG + Intergenic
1147659861 17:42111753-42111775 CGGCACCTAGAGACTGTGGATGG - Exonic
1147665946 17:42148160-42148182 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1147752762 17:42746427-42746449 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1147756028 17:42768558-42768580 CAGCACTAGGAGGCTGAGGCAGG + Intergenic
1147848140 17:43419819-43419841 CAGCACTGTGAGGCTGAGGCGGG - Intergenic
1148051239 17:44770866-44770888 CATCACTGGGAGGCTGAGGTGGG + Intronic
1148240717 17:45997967-45997989 CAGCACTGGGGAGCTGGGGAAGG + Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1148775166 17:50091145-50091167 CAGTCCTGGCAGGCTGTGGAGGG + Intergenic
1148821323 17:50361352-50361374 CAACACTGGGAGGCTGAGGCAGG + Intronic
1149472862 17:56933251-56933273 CAACACTGGGAGACTGAGGTGGG - Intergenic
1149930792 17:60753088-60753110 CAGCACTGGGAGGCTGAGATGGG - Intronic
1150136685 17:62699652-62699674 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1150291253 17:63983615-63983637 CTGCTCTGAGAGACTTTGGAGGG + Intergenic
1150493432 17:65589819-65589841 CAGCACTGGGAGGCTGAGGCGGG + Intronic
1150732471 17:67707963-67707985 CAGCACTTGGAGTCTGAGGCAGG + Intergenic
1151237375 17:72730996-72731018 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1151238955 17:72743120-72743142 CAGCTTTGGGAGATTGGGGAAGG + Intronic
1151251252 17:72837088-72837110 CAGCACGGGGAGACTGCACAAGG + Intronic
1151310264 17:73288503-73288525 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1151628254 17:75291446-75291468 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
1151706123 17:75768846-75768868 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1151728685 17:75898597-75898619 CAACACTGGGAGGCTGAGAAGGG - Intergenic
1151781065 17:76245777-76245799 CAGCACTGGGAGGCTGACGCGGG + Intergenic
1151894818 17:76972853-76972875 AATCCCTGGGAGACAGTGGATGG + Intergenic
1151898014 17:76993427-76993449 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152227956 17:79101453-79101475 CAGGGCTGGGACACTGGGGACGG + Intronic
1152485433 17:80588407-80588429 CAACACTGGGAGGCTGAGGAGGG - Intronic
1153245743 18:3071603-3071625 CAACACTGGGAGGCTGAGGCGGG - Intronic
1153649590 18:7228340-7228362 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1153860704 18:9202072-9202094 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1154118480 18:11632603-11632625 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1154162761 18:11992088-11992110 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155495861 18:26441039-26441061 CAACACTGGGAGGCTGAGGCGGG + Intergenic
1156258283 18:35420637-35420659 CAGCACTGGGAGGCTCAGGTGGG + Intergenic
1156369887 18:36463740-36463762 CAGCACTGGGAGGCTAAGGCGGG - Intronic
1157530392 18:48415381-48415403 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1157583728 18:48788081-48788103 TATCACTGGGAGACTCTGAAAGG - Intronic
1157679092 18:49589698-49589720 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1158581972 18:58691620-58691642 CAACACTGGGAGTCTGAGGTGGG + Intronic
1158986325 18:62821181-62821203 CAACACTGGGAGGCTGAGGTGGG + Intronic
1160063211 18:75550727-75550749 CAGCACTGGGGAACTTGGGAGGG - Intergenic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160709284 19:543596-543618 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1160769495 19:823948-823970 CAGGAGTGGGAGAGTGTGCAGGG + Intergenic
1161377864 19:3949461-3949483 CAGCCCATGGAGTCTGTGGAGGG + Intergenic
1161445220 19:4314731-4314753 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1161760081 19:6164675-6164697 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1162292152 19:9788275-9788297 CAGCACTGGGAGGCTGCAGCAGG - Intronic
1162507851 19:11097616-11097638 CAGCACTGAGAGGCTGAGGCAGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163149320 19:15401673-15401695 CTGGACTGGGAGATTGGGGAGGG - Intronic
1163793892 19:19324496-19324518 CAGCCCTGGGAGACAAGGGAAGG - Intronic
1163993056 19:21017401-21017423 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1164277902 19:23737931-23737953 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1165010754 19:32844581-32844603 CAGCACTGGGAGACTGAGGCAGG + Intronic
1165040068 19:33062852-33062874 CCGCACTGGGAAAGAGTGGATGG - Intronic
1165396692 19:35568266-35568288 CAGCACTAGGAGGCTGAGGCGGG + Intergenic
1165694597 19:37891408-37891430 CAGCACTGGGACGCTGAGGTGGG - Intronic
1165817044 19:38648589-38648611 CAGGACTGGGGGTCTGAGGAGGG + Intronic
1165852406 19:38857301-38857323 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1165879317 19:39031654-39031676 CAGCATTGGGAGCCGGTGGGAGG - Intronic
1165985808 19:39767829-39767851 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1166098379 19:40555674-40555696 CAACACTGGGAGGCTGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166793215 19:45410131-45410153 CAGCACTGGGAGGCTGAGGCAGG - Exonic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167156146 19:47740499-47740521 CAGCATTGGGAGGCTGAGGCGGG + Intronic
1167578620 19:50329397-50329419 CAGCACTGGTAGCCAGGGGAAGG + Intronic
1167744703 19:51343750-51343772 CAACACTGGGAGGCTGAGGCGGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168095725 19:54113937-54113959 TAGCACTGGGAGGCTGAGGCAGG - Intronic
925183290 2:1830718-1830740 CAGGCCTGGGGAACTGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925663487 2:6227218-6227240 CAGCACTTTGAGACTGAGGCAGG - Intergenic
925695953 2:6578662-6578684 CAGCACTGGGAGCCTGTCTGTGG + Intergenic
926412730 2:12621220-12621242 CAACACTGGGAGGCCGAGGAGGG + Intergenic
927915104 2:26930574-26930596 CAGCACTGGGAGGCTGCGGCAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928155009 2:28868764-28868786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
928274673 2:29889630-29889652 CAGTACTGGGGGTCTGTGCATGG - Intronic
928408948 2:31038990-31039012 CAGCACTGGAAGGCTGAGGTGGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928843484 2:35639471-35639493 CAGCACTGGCAGGGTGTGGGAGG + Intergenic
928843592 2:35641421-35641443 CAGCACTGGCAGGGTGTGGGAGG + Intergenic
929195562 2:39180933-39180955 CAGCACTGGGAGGCCGAGGTGGG - Intronic
929202162 2:39246989-39247011 CAACACTGGGAGGCTGAGGTGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930700977 2:54457174-54457196 CAGCCCTGGGAGAGTGGGGACGG - Intronic
931413504 2:62058525-62058547 CAGCACTGGGAGGCTGAGGTGGG + Intronic
931949021 2:67340649-67340671 CAGCCCTGGGAGAGCATGGAAGG - Intergenic
932531382 2:72537353-72537375 CAGCACTGGGAGGCTGAGGCAGG + Intronic
933606356 2:84388624-84388646 CAGGCCTGGGAGACTGTGACAGG - Intergenic
934122685 2:88855478-88855500 CAGTACTGGGAAAGTGGGGAAGG - Intergenic
935002521 2:99033592-99033614 CAGCACTGGGAGGCTGAGGTGGG + Intronic
935200973 2:100856350-100856372 CAGCATTGGGAGCCTGTGCTCGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935847583 2:107183563-107183585 CAACACTGGGAGGCTGAGGAGGG + Intergenic
935872224 2:107463473-107463495 CAACACTGGGAGGCTGAGGTGGG + Intergenic
936757654 2:115734407-115734429 CAGCACTGGGAGGCCGAGGTGGG + Intronic
937321025 2:120960843-120960865 CACCACTGGGAGACCAGGGAGGG - Intronic
937432568 2:121851741-121851763 CAGCTCTGGGAGAACGTGGCAGG - Intergenic
937525591 2:122765071-122765093 CAGCACAGACAGACAGTGGAAGG - Intergenic
937922765 2:127143524-127143546 CAGCACCGGGAGGCTGAGGTGGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938657092 2:133445708-133445730 CAGCACAGGGAGAGTAAGGAAGG + Intronic
938792639 2:134690530-134690552 CAGCACTGGGAGGCTGAGGCTGG - Intronic
939491433 2:142881998-142882020 CAGCACTGGGAGGCCGAGGCAGG - Intronic
940337507 2:152544702-152544724 CAGAACTGGAAAAATGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940943685 2:159592394-159592416 CAGCACTGGGAAGCTGAGGCAGG - Intronic
941648666 2:168069162-168069184 CAGCACTTGGAGGCTGAGGCGGG - Intronic
941999946 2:171636185-171636207 CAACACTGGGAGGCTGAGGTGGG - Intergenic
942407505 2:175671198-175671220 CAGCACTGGGAGCCTGAGGCGGG + Intergenic
942639073 2:178041486-178041508 CAGCACTTGGAGGCTGAGGCGGG - Intronic
943142720 2:184002662-184002684 CAGGACTGAGAGACTGAGGGAGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945241761 2:207682712-207682734 CAGCACTTTGAGACTTTGGGAGG - Intergenic
945528927 2:210925926-210925948 TAGCACAAGGAGACTGTGGCAGG - Intergenic
945737192 2:213615342-213615364 CAGCACTGGGAGGCTGAGGCGGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
947529216 2:230898241-230898263 CATCACTGGCAGCCTGAGGATGG - Intergenic
947607247 2:231495671-231495693 CAACACTGGGAGGCTGAGGAGGG - Intergenic
947965830 2:234280816-234280838 CATCACTCGTGGACTGTGGATGG - Intergenic
948179962 2:235972023-235972045 CAGCACTGGGAGGCTGAGGTGGG - Intronic
948247959 2:236502328-236502350 CAGCACTGGGTGACTGAGGTGGG + Intronic
948391467 2:237614450-237614472 CAGCACTGTGAGACTGCTGGAGG - Intergenic
948792799 2:240388059-240388081 CAGGCCAGGGAGGCTGTGGAAGG + Intergenic
1168809853 20:698033-698055 GGGCACTGGGAGGCTCTGGAGGG + Intergenic
1168994871 20:2125636-2125658 CAGCACAGGCACACTGTGGCAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169239412 20:3962945-3962967 CAACACTGGGAGGCTGAGGTGGG - Intronic
1169372212 20:5036609-5036631 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
1169478791 20:5958122-5958144 CAGCACTGGGAGTCCGAGGCAGG + Intronic
1169945247 20:10981155-10981177 CAGAAGTGGCAGACTGTGGAAGG + Intergenic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170946073 20:20892046-20892068 CAGAACTGGAAGACTGGGAATGG - Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1172150924 20:32789838-32789860 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1172391046 20:34565504-34565526 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1172956042 20:38759917-38759939 CAACACTGAGAGGCTGAGGAGGG + Intronic
1173496598 20:43523494-43523516 CAGCACTGGTTGCCTCTGGAGGG - Intronic
1173531516 20:43773116-43773138 CTGCCCTGGGGGACTGTGGGAGG + Intergenic
1173634762 20:44545572-44545594 TAGCACTGGGAGGCTGAGGCAGG + Intronic
1174575566 20:51534579-51534601 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1175300718 20:57940957-57940979 CTGCCCTGAGAAACTGTGGAAGG + Intergenic
1175592718 20:60206416-60206438 CATCACTGGGTGGCTGGGGAAGG + Intergenic
1175989365 20:62780036-62780058 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1176004057 20:62850098-62850120 TGGCACTGGGATTCTGTGGAAGG + Intronic
1176230712 20:64031426-64031448 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1176271740 20:64238996-64239018 CATTCCTGGGAGGCTGTGGATGG - Intronic
1176376802 21:6090794-6090816 CAGCCCTGAGAGGCTGGGGATGG - Intergenic
1177349212 21:19913153-19913175 CACCACTGGGAGGCTGAGGTGGG + Intergenic
1177538956 21:22466532-22466554 CAGCTCTGGGCGACAGTGGAAGG + Intergenic
1177798666 21:25806068-25806090 CAGCACTGGGAGATGGTGCCTGG - Intergenic
1178025803 21:28465089-28465111 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
1178296389 21:31413813-31413835 CAGCACTGGAACCCTGTGGAAGG - Intronic
1178395858 21:32242743-32242765 CAACACTGGGAGCTTCTGGAGGG - Intergenic
1179041017 21:37802253-37802275 CAGGCCTGGGAGACTGTGGCAGG + Intronic
1179633207 21:42691355-42691377 TAGGACTGGGTGACTTTGGATGG - Intronic
1179746673 21:43447450-43447472 CAGCCCTGAGAGGCTGGGGATGG + Intergenic
1180213579 21:46311116-46311138 CAACACTGGGAGGCTGAGGCGGG - Intronic
1180225626 21:46390452-46390474 CTGAACTGGGAGGCTGAGGAGGG + Intronic
1180762546 22:18221023-18221045 CAGCCCTGGAAGGCTGTGCATGG - Intergenic
1180773121 22:18403585-18403607 CAGCCCTGGAAGGCTGTGCATGG + Intergenic
1180804476 22:18653134-18653156 CAGCCCTGGAAGGCTGTGCATGG + Intergenic
1180806274 22:18716276-18716298 CAGCCCTGGAAGGCTGTGCATGG - Intergenic
1180859264 22:19067929-19067951 CAGCGCTGGGTGACTGCGGGTGG + Intronic
1181217221 22:21342057-21342079 CAGCCCTGGAAGGCTGTGCATGG - Intergenic
1181555776 22:23670973-23670995 CAGCCCTGGGGGACAGTGCAAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182106243 22:27691823-27691845 CAGCACTTGTTGGCTGTGGAAGG - Intergenic
1182146606 22:28000627-28000649 GAGCCCTGTGGGACTGTGGAGGG + Intronic
1182333754 22:29569492-29569514 CAACACTGGGAGGCTGAGGCAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182963818 22:34503131-34503153 TAGGACTGGGAAACTGTTGAAGG - Intergenic
1183176598 22:36229045-36229067 AAGCAGTGGGTGAGTGTGGAAGG - Intronic
1183181631 22:36264047-36264069 AAGCAGTGGGTGGCTGTGGAAGG + Intronic
1183411375 22:37656738-37656760 CAGCACTGGGAGCCTGAGGCAGG + Intronic
1183450201 22:37889850-37889872 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1183461121 22:37951300-37951322 CAACACTGGGAGGCTGAGGTGGG - Intronic
1183516728 22:38271202-38271224 CAGCACTGGGAGCCCCTAGAAGG + Intronic
1183574049 22:38675757-38675779 CAGCACAGTGACACAGTGGAAGG + Intergenic
1183602634 22:38848950-38848972 CAGCACTGAGACAGTGTGGTGGG - Intergenic
1183642882 22:39102751-39102773 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1183699244 22:39440962-39440984 CAGCACTGGGAGGCTGAGGTTGG + Intergenic
1184156098 22:42668221-42668243 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184441624 22:44520256-44520278 CAGAATTGGGAGACTATGGTTGG - Intergenic
1184733656 22:46385341-46385363 CAGCACTGGGAGGCTGAGATGGG - Intronic
1185054042 22:48568838-48568860 CAGCACTGCTGGACAGTGGAAGG - Intronic
1203234953 22_KI270731v1_random:144567-144589 CAGCCCTGGAAGGCTGTGCATGG + Intergenic
949921005 3:9000429-9000451 CAGGACTCTGAGACTGGGGATGG - Intronic
950348721 3:12325172-12325194 CAACACTGGGAGGCTGAGGTGGG + Intronic
951877338 3:27441732-27441754 CAACACTGGGAGACTGAGGCAGG - Intronic
952088580 3:29856382-29856404 CAGATCTGGGAGATTGTGAAAGG + Intronic
952755559 3:36863073-36863095 CAGCTCTGGAAGACAGTTGAGGG + Intronic
952819026 3:37470041-37470063 CAGCACTGGGAGGCCGAGGTGGG - Intronic
953216227 3:40921531-40921553 CAGGACTGGGAGAGACTGGAAGG - Intergenic
953569066 3:44057290-44057312 CAGCACTGAGAGACTTTTAAAGG - Intergenic
953917412 3:46929429-46929451 CAGCTCTTGGAGACTGGGCAGGG + Intronic
953991552 3:47487849-47487871 CAGCACTGGGAGGCCGAGGTAGG - Intergenic
954028005 3:47798389-47798411 CGGCACTGGGAGGCTGAGGCGGG - Intergenic
954058054 3:48044514-48044536 CAGCACTGGGAGGCCGAGGTGGG + Intronic
954185350 3:48912797-48912819 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
954341465 3:49957390-49957412 AAGCACTGGGAGGCTGAGGCAGG - Intronic
954387213 3:50250435-50250457 CAGAATTGGGACACTGTGAATGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954555427 3:51513777-51513799 CAGCTCTGGGAGGCTGAGGCGGG + Intergenic
954574357 3:51667410-51667432 CATCACTGGGAGGCCGAGGAGGG - Exonic
954956109 3:54519389-54519411 GAGCACTGTGAGATGGTGGAGGG - Intronic
955374555 3:58384197-58384219 CATCACTGGGAGCTTGTTGAAGG + Intronic
955802703 3:62702428-62702450 CAGGCCTGGGAGACTCTGCAGGG + Intronic
956136206 3:66101459-66101481 CAACACTGGGAGGCTGAGGAGGG + Intergenic
956822101 3:72963324-72963346 CAGCACTGGGAGGCTGAGGCGGG + Intronic
956858716 3:73301429-73301451 CAGCACTGGGAGGCTCAGGTGGG - Intergenic
958193231 3:90210127-90210149 CAGAACTGGGAGGCTGAGGCAGG + Intergenic
958416534 3:93881074-93881096 CAGCACTGGGAGGCTGAGGCAGG + Intronic
958940985 3:100314519-100314541 CAGCACTGGGAGGCTGAGGTGGG + Intronic
959071739 3:101707822-101707844 CAACACTGGGAGGCTGAGGTGGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959701007 3:109299109-109299131 TAGCACTGGGAGGCTGAGGCAGG + Intronic
959708268 3:109359288-109359310 CAACACTGGGAGAATGAGGCAGG - Intergenic
960416200 3:117388196-117388218 AAGCACTGGGTGACTTTGGGAGG + Intergenic
960512971 3:118572323-118572345 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
960760446 3:121068252-121068274 CAGCACTGGGAGGCCGAGGCAGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960963299 3:123087770-123087792 CAGCTCTGTGAGTGTGTGGAGGG + Intronic
961412649 3:126733946-126733968 ATGCACTGGCACACTGTGGATGG - Intronic
961471308 3:127114866-127114888 CAGCAATGAGAGCCTGGGGAGGG + Intergenic
961481141 3:127181688-127181710 CAGCACTGGGGGGCTGAGGCAGG + Intergenic
961581758 3:127888910-127888932 CAGCGCTGGGTGGCTGTGGGAGG - Intergenic
962518559 3:136176576-136176598 CAGCATTGGGAGGCTGAGGCAGG + Intronic
962520888 3:136196409-136196431 TAGCTCTGGGAGGCTGTGGAGGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963903155 3:150751920-150751942 CAGCCCTGGGAGTCTCTGTAAGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964069521 3:152614727-152614749 CAGTCCTGGGAGACTGAGGCAGG + Intergenic
964123187 3:153207554-153207576 CAACACTGGGAGGCTGAGGCGGG - Intergenic
966276187 3:178172872-178172894 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
966376439 3:179300788-179300810 CAACACTGGGAGGCTGAGGCGGG - Intergenic
966642239 3:182204043-182204065 GAGCAATGGGAGAATGGGGAGGG - Intergenic
966727629 3:183121420-183121442 CATCTCTGGTACACTGTGGAAGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967194212 3:187012628-187012650 CAGGACTGAGAGAGTGTGGTGGG - Intronic
967605589 3:191441988-191442010 CGGCAGTGACAGACTGTGGAGGG + Intergenic
967612547 3:191524454-191524476 GAGCACTGGGAGGCTGAGGCAGG - Intergenic
967712629 3:192727023-192727045 CAGCACTGGGGAAGTGTGGCAGG - Intronic
968141484 3:196261408-196261430 CAGCACTGGGAGGCCGAGGCAGG + Intronic
968493623 4:903574-903596 CACCACTGGGGGGCTGAGGAAGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968922637 4:3530647-3530669 CAGCACCGGGGGACAGTGCAGGG + Intronic
968960409 4:3740338-3740360 CAGCACTGCCAGACTGTGAAGGG + Intergenic
969232220 4:5839744-5839766 CAAAATTGGAAGACTGTGGAGGG + Intronic
969537323 4:7764643-7764665 CAGCACTCAGGGCCTGTGGATGG - Intronic
969806198 4:9610936-9610958 CAACACTGGGAGACCGAGGCAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971729638 4:30361050-30361072 CAGCAGTAGGAGGCTGTGGTGGG + Intergenic
972042031 4:34614703-34614725 AAGCACTGGGAGAATGCAGAAGG + Intergenic
972471256 4:39406851-39406873 TTGAACTGGGAGACTGAGGATGG - Exonic
972629505 4:40831149-40831171 CAGCACTGGGAGGCCGAGGTGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973317242 4:48774791-48774813 CGGCACTCGGAGACTGAGGTGGG - Intronic
973318286 4:48783535-48783557 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
974463366 4:62220021-62220043 TAGCACTGGGACAAAGTGGAAGG + Intergenic
975209961 4:71688545-71688567 AACCACTGCCAGACTGTGGAAGG - Intergenic
975570839 4:75816209-75816231 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975763641 4:77642802-77642824 TAGCACTAAGAGAGTGTGGATGG + Intergenic
976278650 4:83304577-83304599 CAACACTGGGAGGCTGAGGTGGG + Intronic
976782400 4:88775455-88775477 CAGCACTGGGAGGCTGAGGTGGG + Intronic
976839129 4:89410789-89410811 CAACACTAGCAGACTGTGGGTGG - Intergenic
977120361 4:93092148-93092170 CAACACTGGAAGTCTGTTGATGG + Intronic
977799360 4:101207578-101207600 CAGCACTGGGAGGCCGAGGTGGG + Intronic
977808570 4:101332896-101332918 CATCACTGGAAGTATGTGGAGGG + Intronic
977823428 4:101502583-101502605 GAGCCCTGGGAGACTGGGGTGGG + Intronic
978141336 4:105320684-105320706 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978443487 4:108758802-108758824 CAGCACTGGGAGGCCGAGGCGGG + Intronic
978621786 4:110640106-110640128 CTGGACTGGGAGCCTGGGGAAGG + Intronic
979073675 4:116243051-116243073 CAGACTTGTGAGACTGTGGATGG + Intergenic
979080406 4:116331804-116331826 CAGCTTTGGGAAAATGTGGAGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984337215 4:178408012-178408034 CAGCACTTTGAGGCTGAGGAGGG - Intergenic
984458869 4:180007780-180007802 TAGCACTGGGAGGCTGAGGGTGG + Intergenic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
984645839 4:182218974-182218996 CAGCACTGGGAGGCCGAGGCAGG + Intronic
984738099 4:183130296-183130318 CAGCACTGGGAGGCCGAGGCAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986321201 5:6633707-6633729 CGGCACTCGGAGCCTGTGGCTGG - Exonic
988075168 5:26342973-26342995 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
988112675 5:26843279-26843301 CAACACTGGGAGACCAAGGAGGG + Intergenic
988727262 5:33937688-33937710 CAGCGCCCGGAGACTGTCGAAGG + Exonic
988998844 5:36740628-36740650 CAGAAATGTGATACTGTGGACGG - Intergenic
988999281 5:36744261-36744283 CAGAAATGTGATACTGTGGACGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989782256 5:45281836-45281858 CAACACTGGGAGGCTGAGGCAGG - Intronic
991068893 5:62455271-62455293 CAGCACTGGGAGGCCGTGGTGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991379803 5:66008168-66008190 CAACACTGGGAGGCTGAGGTGGG + Intronic
992054651 5:72976453-72976475 GAGCTTTGGGAGACTGTGGCGGG - Intronic
992129124 5:73673923-73673945 CAACACTGGGAGGCTGAGGTGGG + Intronic
992320018 5:75604621-75604643 GAGCTTTGGGAGACTGAGGAAGG - Intergenic
992868870 5:80985746-80985768 CAGCACAGGAAGGATGTGGAGGG + Intronic
994340129 5:98617261-98617283 CAGCACTGGGAGACTGAGGCAGG + Intergenic
995216827 5:109604954-109604976 CAGCACTGGGAAGCTGAGGAGGG + Intergenic
995558944 5:113360021-113360043 CATAAATGGGAGACTGTGAATGG + Intronic
996173397 5:120324197-120324219 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
996252892 5:121359265-121359287 TAGCACTGGGAAATTGTGCAAGG - Intergenic
996954272 5:129164401-129164423 CTGCACTGGCAGACTGTGACTGG - Intergenic
997985701 5:138499819-138499841 TAGCACTGGGAGGCTGAGGCGGG + Intergenic
998089375 5:139355072-139355094 CAGCACTTTGGGACTTTGGAAGG - Intronic
998138822 5:139688617-139688639 AAGCACTGGGAGGCTGCGGTAGG - Intergenic
998157149 5:139793498-139793520 TAGCTCTGGGAGCCTGTGGCAGG - Intergenic
999070641 5:148740001-148740023 CAGCACTGTGAGGATGTTGATGG + Intergenic
999253904 5:150199018-150199040 CAGCTTTGGGAGGCTGAGGAAGG - Intronic
999275517 5:150327393-150327415 AAGAACTGGGAGACTGAGGTAGG - Intronic
999355739 5:150928923-150928945 CAACACTGGGAGGCTGAGGCGGG - Intergenic
999734273 5:154500964-154500986 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1000256988 5:159548808-159548830 CAGCAATGGGTGAATGTGGGTGG + Intergenic
1001126248 5:169022191-169022213 CGGCTCTGGGAGACTCTCGAAGG - Intronic
1001130224 5:169057635-169057657 CGGCACTGGCCGAATGTGGAAGG + Intronic
1001592437 5:172874678-172874700 CAACACTGGGAGGCTGAGGCAGG + Intronic
1001713036 5:173793238-173793260 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1001775914 5:174329021-174329043 CAGCCCTGTGGGCCTGTGGATGG + Intergenic
1001821484 5:174713727-174713749 CTGGAGTGGGAGACTGTTGAAGG + Intergenic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002107642 5:176888010-176888032 CAACACTGGGAGGCTGAGGTGGG - Intronic
1002124285 5:177030370-177030392 CAGCACTGGGAGGCCGAGGCGGG + Intronic
1002172097 5:177380926-177380948 CAGCACTTGGAGGCTGAGGTGGG - Intronic
1002197507 5:177509366-177509388 CAGACCTGGGAGACTTGGGAAGG - Intronic
1002494233 5:179600942-179600964 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1002525946 5:179816392-179816414 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1002780783 6:364180-364202 AAGGACTGGGAAACTGTGGACGG - Intergenic
1003165295 6:3672046-3672068 CAGCCCTGGGTGAGGGTGGAGGG + Intergenic
1003678041 6:8225193-8225215 CAGCAATGGGAGGCTGAGGTGGG - Intergenic
1004382317 6:15143163-15143185 CAGAACTGGGGGTCTGGGGAAGG - Intergenic
1004637887 6:17486355-17486377 CAGCACTGGGAGGCTAAGGCGGG + Intronic
1005031110 6:21510047-21510069 CAGCAGTGAGACACTGTGTAAGG - Intergenic
1005432119 6:25769134-25769156 TAGCCCTGGGAGTCAGTGGAGGG - Exonic
1006578387 6:35062197-35062219 CAGCACTGAGAGCCCCTGGAAGG - Intronic
1006798177 6:36743976-36743998 CAGCCCTGGGAGTCTGGGGAGGG - Intronic
1006820286 6:36887969-36887991 CAACACTGGGAGGCTGAGGTGGG - Intronic
1007460488 6:42014674-42014696 CAGCACTGGGAGGCTGAGGTTGG + Intronic
1007565136 6:42844261-42844283 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1007722284 6:43892059-43892081 CAACACTGGGAGGCTGAGGCGGG + Intergenic
1007741208 6:44010653-44010675 CAGCACTGAGAGACCGAGGCAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009461708 6:63921236-63921258 CTGCACTGTGTGACTGTGGAGGG + Intronic
1009608250 6:65902393-65902415 CATCAATGGGAGAGTGAGGATGG - Intergenic
1010212602 6:73373942-73373964 CATCACTGGGAGGCTGAGGCGGG + Intronic
1011078971 6:83468237-83468259 CAAACCTGGGAGAATGTGGAGGG + Intergenic
1011470570 6:87703498-87703520 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1011970393 6:93215028-93215050 CAACACTGGGAGAGTATGGGAGG - Intergenic
1012520448 6:100115092-100115114 GAGCCCTGGGCCACTGTGGAAGG - Intergenic
1013217434 6:108040531-108040553 CAACACTGGGAGGCTGAGGCTGG - Intergenic
1013312620 6:108910215-108910237 CAACACTGGGAGGCTGAGGTGGG + Intronic
1013809580 6:114029234-114029256 CAGCTTTGGGAGGCTGTGGCAGG - Intergenic
1014757079 6:125313180-125313202 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1015304933 6:131697013-131697035 CGGCACTGGGAGACCAAGGAGGG - Intronic
1015983612 6:138863858-138863880 CAACACTGGGAGGCTGAGGCGGG - Intronic
1015986306 6:138887470-138887492 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1016746909 6:147590657-147590679 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1017307454 6:152935682-152935704 CAGCACTGGGAGGCTGAGGAGGG - Intergenic
1017396213 6:154002583-154002605 GACCACTGGGAGCCAGTGGAAGG + Intergenic
1017721976 6:157249789-157249811 CAGGAGTGGGAGGATGTGGAGGG - Intergenic
1017978078 6:159375392-159375414 TAGGACTGGGGGACTGAGGACGG - Intergenic
1018054877 6:160043156-160043178 CAGAATTGGGAAGCTGTGGATGG + Exonic
1018232897 6:161692656-161692678 CAGCACTGGGAGGCTGAGGGGGG + Intronic
1018242883 6:161795478-161795500 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1018398443 6:163399441-163399463 CAACACTGGGAGGCTGAGGCAGG + Intergenic
1018441303 6:163815962-163815984 CAGCACAGAGAGCCTGGGGAAGG - Intergenic
1018443142 6:163831763-163831785 CAACACTGCTACACTGTGGAAGG + Intergenic
1019327159 7:444151-444173 AGCCACTGGGAGAGTGTGGAGGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019522129 7:1465841-1465863 CAGAGCTGGGATACGGTGGAGGG - Intergenic
1019670293 7:2274346-2274368 CAGGACACGGTGACTGTGGAAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019965316 7:4494094-4494116 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1020303882 7:6817764-6817786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1020389343 7:7641540-7641562 CCACACTGCGAGACTCTGGAGGG + Intronic
1020462433 7:8440819-8440841 CAGGACTGGGAGGATGGGGAAGG - Intronic
1020512295 7:9073081-9073103 CAGCACTGGGAGGCTGAGGTAGG - Intergenic
1020525265 7:9251187-9251209 CAGCTGTGGCAGACTGTGGCTGG + Intergenic
1020834652 7:13134358-13134380 CAGCACTGGGAGGCAGAGGCTGG - Intergenic
1021310597 7:19091267-19091289 CAGCAATGTGATACTGTGCAAGG - Intronic
1021425508 7:20495526-20495548 CTGCACAGGGATACTGTGCACGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022011375 7:26310645-26310667 CAGCACGAGGGGACTGAGGAAGG + Intronic
1022659098 7:32349391-32349413 AGGGACTGGGAGAGTGTGGAGGG + Intergenic
1023757908 7:43436974-43436996 CTGCTCTGGGAGACTGAGGCAGG - Intronic
1023776996 7:43617240-43617262 GAGCAATGGGAGGCTGTGGAAGG + Intronic
1025257671 7:57396407-57396429 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1025619635 7:63156898-63156920 CAACACTGGGAGGCTGAGGCGGG + Intergenic
1025729546 7:64097842-64097864 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1025952632 7:66157547-66157569 CAGCACTTGGAGACTGAGACAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026315686 7:69225245-69225267 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1026852624 7:73734786-73734808 CAGCACTCGGAGGCTGAGGCAGG - Intergenic
1026884094 7:73927864-73927886 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1026948481 7:74331819-74331841 CAGCACTTTGAGACTGAGGCGGG - Intronic
1028147360 7:87332783-87332805 CAGCACTGGGAAGCTGAGGCAGG + Intergenic
1028541282 7:91945112-91945134 CAACACTGGGAGGCTGAGGTGGG + Intronic
1028996414 7:97105182-97105204 CAACACTGGGAGGCTGAGGCGGG + Intergenic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029411928 7:100418542-100418564 CAGCACTGAGAGGCTGAGGTGGG + Intronic
1029498579 7:100912644-100912666 CAGCATTGGGAGGCTGAGGTGGG + Intergenic
1029856448 7:103522083-103522105 CAGAACTGGCTGACTGTGAACGG - Exonic
1031928411 7:127660376-127660398 CTTGACTGGGAGACTGTGGTGGG + Intronic
1031976948 7:128100161-128100183 CAGCACTGGGAGACCAAGGCGGG + Intergenic
1032260899 7:130336198-130336220 CAACACTGGGAGGCTGAGGCGGG + Intergenic
1032390128 7:131550406-131550428 TAGCACTGGGAGGCTGAGGTGGG + Intronic
1032626693 7:133598733-133598755 CAGCACTGGGAGGCTGAAGCGGG + Intronic
1033208942 7:139446087-139446109 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034972990 7:155430772-155430794 CCGCACAGGAAGGCTGTGGAGGG + Intergenic
1035223672 7:157421882-157421904 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1035522530 8:286740-286762 GAGCCCTGGGAAGCTGTGGAAGG - Intergenic
1035750724 8:1994258-1994280 CAGCACTGGGATCCTGGGGCAGG - Intronic
1035898927 8:3436055-3436077 CAGCAGTGTGAGTCTCTGGAAGG - Intronic
1036126094 8:6063863-6063885 AAGCACTGGAGGACTTTGGAGGG - Intergenic
1037608441 8:20456834-20456856 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1038293621 8:26271430-26271452 CAGCACTGGGAGGTTGAGGCAGG - Intergenic
1038325601 8:26570490-26570512 CAACACTGGGAGGCTGAGGTGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038780303 8:30564323-30564345 AATCACTGGGAGAGTGTGCAGGG + Intronic
1038781557 8:30572638-30572660 CAACACTGGGAAACTGAGGCAGG + Intergenic
1039027122 8:33270319-33270341 CAGCCCTGGGAGACCATAGAGGG + Intergenic
1039444942 8:37623446-37623468 CAACACTGGGAGGCTGAGGCGGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040444420 8:47479110-47479132 CAACACTGAGAGACTGAGGCAGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040880760 8:52201762-52201784 CAGCCCAGGGAGTCTGAGGACGG - Intronic
1041675773 8:60537924-60537946 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1042307360 8:67345416-67345438 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1042365103 8:67927216-67927238 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1042829957 8:73016004-73016026 CAGCTCTGGGAGGCTGAGGTGGG + Intronic
1043648899 8:82561765-82561787 CAAGACTGGATGACTGTGGAAGG + Intergenic
1044243868 8:89918410-89918432 CAGCACTGGGAGGCTAAGGCAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045163825 8:99580601-99580623 CAACACTGGGAGGCTGAGGTGGG + Intronic
1045880180 8:107029331-107029353 TATCACTGGGAACCTGTGGAGGG - Intergenic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046537894 8:115539589-115539611 CAACACTGGGAGGCTGAGAAGGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046772401 8:118129036-118129058 CAACACTGGGAGGCTGAGGTAGG - Intergenic
1047524580 8:125621866-125621888 GAGAACTGGGAGATTGTGAAAGG - Intergenic
1048123707 8:131609221-131609243 CAGCATTGGGAGAATATGAATGG - Intergenic
1048500668 8:134971891-134971913 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1048763643 8:137824176-137824198 CAGCTTTGGGAGGCTGAGGAGGG + Intergenic
1048804909 8:138231129-138231151 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1048818879 8:138361172-138361194 CAGCTTTGGGAGGCTGAGGAGGG - Intronic
1049837607 8:144748318-144748340 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1049918107 9:337905-337927 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051212704 9:14761814-14761836 AAGCACTGTGACACTGTGGCTGG - Intronic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1052291943 9:26852168-26852190 GAGCCCTGGGAGACTGAGGTGGG - Intronic
1053157983 9:35793136-35793158 CAGCACTGGGGAACTGTAGATGG + Intronic
1053202437 9:36161936-36161958 CAGCACTGGGAGACTGAGGCAGG + Intronic
1053344152 9:37365587-37365609 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1054361201 9:64122187-64122209 CTACACTGGGAGGCTGTGGTAGG + Intergenic
1054903468 9:70393440-70393462 CAGCTCAGGGAGTCTGGGGAGGG - Intronic
1055196510 9:73600815-73600837 CAGCCTTGGGAGACTGAGCAGGG - Intergenic
1055408747 9:76004148-76004170 CAGGAATGGGAAACTGAGGAGGG + Intronic
1056326883 9:85487529-85487551 CAGCACTGTGGCACTGTGGGAGG + Intergenic
1056400712 9:86224679-86224701 AAGCACTGGGAGGCTGAGGCAGG + Intronic
1057020859 9:91696831-91696853 CAACACTGGGAGGCTGAGGCAGG - Intronic
1057262032 9:93590403-93590425 CAGGAGTGGGAGAGAGTGGAAGG - Intronic
1057361500 9:94377627-94377649 CAGCACTGGGAGGCTGAGACAGG - Intronic
1057475014 9:95391832-95391854 CAGCACTTGGAGGCCGAGGAGGG - Intergenic
1057601039 9:96457379-96457401 CAGCACTTGGACACTGTGCTGGG - Intronic
1058054328 9:100434279-100434301 CAACACTGGGAGGCTGAGGCAGG + Intronic
1058515282 9:105766045-105766067 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1058862161 9:109126976-109126998 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
1058877832 9:109259520-109259542 CAGCTCTAGGAGGCCGTGGAGGG + Intronic
1058964146 9:110020859-110020881 AAGCACTGGGAGGCTGAGGTGGG + Intronic
1059267326 9:113047501-113047523 CAACACTGGGAAGCTGAGGAGGG + Intronic
1059632469 9:116139375-116139397 CAGGACTTGGTGACGGTGGAGGG - Intergenic
1059721513 9:116964481-116964503 CAACACTGTGAGACCGTGGCAGG + Intronic
1059777400 9:117489169-117489191 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1059829867 9:118083306-118083328 AAGATCTGGGAGATTGTGGACGG - Intergenic
1060924832 9:127449071-127449093 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1060964479 9:127705103-127705125 CACCTCTGGGAGACTTTGGAGGG - Intronic
1061012236 9:127962489-127962511 CAGCACTATGAGACCCTGGAGGG + Intronic
1061121223 9:128643752-128643774 CTGCACTGAGAACCTGTGGACGG + Intronic
1061156027 9:128862247-128862269 CAGCACTGGGACGCTGCGGCAGG - Intronic
1061585654 9:131566560-131566582 CAACACTGGGAGGCTGAGGCAGG - Intergenic
1061910001 9:133717363-133717385 CAGCACGGGGACCCTGTTGATGG + Exonic
1062329421 9:136030907-136030929 CAGCACTGCGAGGCTGAGGTGGG - Intronic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1062638691 9:137505708-137505730 GAGTGCTGGGAGACCGTGGAGGG + Exonic
1062650137 9:137571539-137571561 CAACACTGGGAGGCTGAGGCAGG + Intronic
1062676034 9:137744564-137744586 CAACACTGGGAGACTGAGGCGGG - Intronic
1185583609 X:1229028-1229050 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1185870109 X:3657791-3657813 CAGCAATGAGAGATTGAGGAAGG + Intronic
1185907456 X:3949273-3949295 CAGCACTGGGAGGCTGAGGTTGG - Intergenic
1186195715 X:7108799-7108821 CAACACTGGGAGACCGAGGCTGG - Intronic
1186622352 X:11254630-11254652 CAGCTCTGAGAGACTCTGGATGG + Exonic
1186827274 X:13352936-13352958 CAACACGGGGAGGCTGAGGAGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189263594 X:39696060-39696082 CAACACTGGGAGGCTGAGGGGGG - Intergenic
1189413984 X:40798182-40798204 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1189785379 X:44554676-44554698 CAGCACTGGGAGGCAGAGGCGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190982008 X:55464392-55464414 CAGCCCTGGCAGACTATAGAGGG + Intergenic
1190986690 X:55508788-55508810 CAGCCCTGGCAGACTATAGAGGG - Intergenic
1191244319 X:58213963-58213985 CAGCACTGGGAGGCTGAGGTGGG - Intergenic
1192122773 X:68472828-68472850 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1192209453 X:69118458-69118480 CTCCACTAAGAGACTGTGGATGG + Intergenic
1192774059 X:74223531-74223553 CAGCACTTGGAGGCTGAGGTGGG - Intergenic
1194344867 X:92751112-92751134 CAGCACTGGCAGAGTGTGCTAGG + Intergenic
1195642759 X:107195061-107195083 CAACACTGGGAGGCTGAGGCAGG - Intronic
1195858104 X:109352315-109352337 GTCCTCTGGGAGACTGTGGATGG + Intergenic
1196606209 X:117660324-117660346 CAGCACTGGGAGGCTGAAGTGGG - Intergenic
1197266819 X:124383191-124383213 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1198444673 X:136700276-136700298 CAGGATTGGGAGGCTGTGGCAGG + Intronic
1199623026 X:149715838-149715860 CAGCACTGCAAGCCTGAGGAAGG + Exonic
1199635468 X:149808235-149808257 CAGCACTGCAAGCCTGAGGATGG + Intergenic
1199875329 X:151923686-151923708 CAGCACTGCAAGCCTGAGGAAGG + Exonic
1199894055 X:152115497-152115519 CAGCACTGCAAGCCTGAGGAAGG - Intergenic
1199955156 X:152736183-152736205 CAGCACTGCAAGCCTGAGGAAGG + Exonic
1200034302 X:153318247-153318269 CAGTCCTGGGAGATGGTGGAAGG - Intergenic
1200182606 X:154159913-154159935 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200188260 X:154197027-154197049 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200193910 X:154234167-154234189 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200199665 X:154271971-154271993 CAGCTTCGGGAGACAGTGGATGG - Intronic
1200227466 X:154426827-154426849 CAACACTGGGAGGCTGAGGCGGG - Intergenic
1200653208 Y:5867754-5867776 CAGCACTGGCAGAGTGTGCTAGG + Intergenic
1200986535 Y:9306981-9307003 CAGCAGTGGGATAATGGGGAGGG + Intergenic
1201549883 Y:15208798-15208820 GTGCACTGGGAGACTGAGGTGGG - Intergenic
1202303920 Y:23447605-23447627 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1202566890 Y:26222986-26223008 CAGCACTGGGAGGCTGAGGCGGG + Intergenic