ID: 1181961074

View in Genome Browser
Species Human (GRCh38)
Location 22:26622205-26622227
Sequence CAGAGCTACCTCTTTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181961069_1181961074 1 Left 1181961069 22:26622181-26622203 CCCTATTGCCTAAATTTCCACCA 0: 1
1: 1
2: 2
3: 13
4: 172
Right 1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 135
1181961070_1181961074 0 Left 1181961070 22:26622182-26622204 CCTATTGCCTAAATTTCCACCAT 0: 1
1: 1
2: 4
3: 28
4: 207
Right 1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 135
1181961071_1181961074 -7 Left 1181961071 22:26622189-26622211 CCTAAATTTCCACCATCAGAGCT 0: 1
1: 0
2: 3
3: 33
4: 250
Right 1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 135
1181961067_1181961074 30 Left 1181961067 22:26622152-26622174 CCTCATTTAAAAACAAATTATTC 0: 1
1: 0
2: 10
3: 91
4: 999
Right 1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 135
1181961068_1181961074 8 Left 1181961068 22:26622174-26622196 CCTGTAGCCCTATTGCCTAAATT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181961074 Original CRISPR CAGAGCTACCTCTTTGAGCT AGG Intronic
902624316 1:17667753-17667775 CAGAGCTGCCCCTGTGAGCTGGG + Intronic
903865008 1:26391690-26391712 CAGGGCATCCTCTCTGAGCTGGG + Intergenic
903952385 1:27003925-27003947 CAGACTTACCTTTTTGGGCTGGG - Intergenic
904813122 1:33176683-33176705 CTGAGCTACCTCTGAGGGCTGGG - Intronic
905535838 1:38721112-38721134 CAGAACAACATCTTTGAGCCTGG + Intergenic
906024654 1:42663364-42663386 CAGATCTATCACTTAGAGCTGGG - Intronic
906393409 1:45439430-45439452 TGGAGCTATTTCTTTGAGCTAGG - Intronic
906754543 1:48297382-48297404 TAGAGCTATCTCTATGAGCCAGG - Exonic
906812296 1:48840275-48840297 CAGAGATACCTCTGTGTGCCCGG + Intronic
907454160 1:54564593-54564615 CAGACCTACCTGCTTCAGCTCGG - Intronic
908928976 1:69293026-69293048 CACAGCTGCATCTATGAGCTGGG - Intergenic
913068907 1:115282857-115282879 CAGCAGTTCCTCTTTGAGCTTGG - Intergenic
915652257 1:157323388-157323410 GAGAGCTACCTCTTTAAGGTAGG + Intergenic
915660029 1:157396920-157396942 AAGAGCTACCTCTTCAAGGTAGG - Intergenic
918052424 1:180986076-180986098 AAGAGCTACCTTTCTGCGCTAGG + Intronic
919649957 1:200137948-200137970 CTTAGCTACCTCTTTGAGAGAGG - Intronic
921500147 1:215891883-215891905 GAGAACTCCCTCTTGGAGCTGGG + Intronic
1063914984 10:10872280-10872302 CAGAGCTGTCTTTTTGACCTGGG + Intergenic
1069511946 10:69049003-69049025 CAGAGCTTCCTGAATGAGCTTGG - Intergenic
1071787923 10:88923724-88923746 CAGAGATATCTCTCTGAGCCTGG - Intronic
1072672893 10:97444227-97444249 CAGAGTTTTCTCTTTGAGCATGG + Intronic
1074432092 10:113402982-113403004 CAGAGCTACAACTTTGTGCCAGG - Intergenic
1075318109 10:121468273-121468295 CAGAGCTGGCTCTTTAAGCCTGG - Intergenic
1081633276 11:44703450-44703472 CAGAGCAAACTGTTTGAGCCTGG + Intergenic
1083280879 11:61626763-61626785 CAGAGCAATCTCTTCGAGGTTGG - Intergenic
1084935937 11:72586649-72586671 CAGAGCTAGCTCCATGAGCAGGG - Intronic
1088793944 11:113251159-113251181 CACAGCTAACTCTTGGTGCTCGG + Intronic
1089154920 11:116394343-116394365 GATAGCAACCTCTTTGAGCTTGG - Intergenic
1090587830 11:128233540-128233562 CACAGCTACCTCTCTGGGCTCGG - Intergenic
1092068437 12:5612662-5612684 CAGAACAACATCTTTGAGATTGG - Exonic
1096857953 12:54498769-54498791 AACAGCTTCCTCTTTGTGCTGGG + Intronic
1100406032 12:94273549-94273571 GAGAGGTACCTCTTTTAGGTCGG - Intronic
1103403389 12:120658546-120658568 CAGAGCTACCTCTGAGCTCTTGG + Intronic
1105112577 13:16642262-16642284 AAGATCCACCTCTTTTAGCTGGG - Intergenic
1106146241 13:27052431-27052453 CAGAGGTACCCCCTTGACCTTGG + Intergenic
1107431633 13:40345716-40345738 CAGTGCTATTTCTCTGAGCTAGG - Intergenic
1107599472 13:41998649-41998671 AAGAGCGACCTCTCTGAGCTGGG + Intergenic
1109202782 13:59449423-59449445 CAGAGTTATCTCCTTCAGCTAGG - Intergenic
1109306789 13:60649898-60649920 CATAGATACCTATTTGAACTAGG - Intergenic
1110085560 13:71374739-71374761 CAAAGCTTCTTCTCTGAGCTAGG + Intergenic
1110264961 13:73527298-73527320 CATGTCAACCTCTTTGAGCTAGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112218625 13:97463398-97463420 CAGAGATACCTATTTTAGTTAGG + Intronic
1112423119 13:99271786-99271808 CAGAGATACTTTTGTGAGCTGGG - Intronic
1114189658 14:20430628-20430650 CAGAGATACCTCTGTGCCCTGGG + Exonic
1114272454 14:21110022-21110044 CAAACCTGCCTCTCTGAGCTGGG - Intergenic
1117420835 14:55543416-55543438 CAGAGCCACCTTTTTGCCCTTGG - Intergenic
1118630446 14:67697640-67697662 CAGCTCTGCCTCTTTGACCTAGG - Intergenic
1118672178 14:68140707-68140729 CAGACCTAACTCTGTGAGCATGG - Intronic
1120828396 14:88975652-88975674 CAGAGCTCTTTCTGTGAGCTGGG - Intergenic
1121115343 14:91339124-91339146 CTGAGCTTACTCTTTGACCTCGG - Intronic
1123947177 15:25244435-25244457 CAGTGGTACCTCCTTGAGCCTGG + Intergenic
1123947994 15:25248167-25248189 CAGTGGTACCTCCTTGAGCCTGG + Intergenic
1124454486 15:29827809-29827831 CAGAGCTGCCTCTATAATCTAGG - Intronic
1125368206 15:38941879-38941901 CAGAACAACATCTTTGAGATGGG - Intergenic
1131687996 15:94792079-94792101 CATAGCCACCTCCTTGTGCTTGG - Intergenic
1133022925 16:2974718-2974740 CAGGGCTGCCTCTTGGAGGTGGG + Intronic
1135521941 16:23184266-23184288 CAGAGGTACCCCTGAGAGCTGGG + Intronic
1139894348 16:70276187-70276209 CAGAGCTTGCTCTGTCAGCTAGG - Intronic
1141758870 16:86013606-86013628 CATAGCTGCCTCCGTGAGCTGGG - Intergenic
1202994306 16_KI270728v1_random:93054-93076 CAAACCAACCTGTTTGAGCTTGG - Intergenic
1203020993 16_KI270728v1_random:405396-405418 CAAACCAACCTGTTTGAGCTTGG - Intergenic
1203039328 16_KI270728v1_random:678554-678576 CAAACCAACCTGTTTGAGCTTGG - Intergenic
1143216046 17:5225780-5225802 CACAACTCCCTCTTTGAGATCGG - Intronic
1148072680 17:44917182-44917204 CTGAGCTGGCTCTGTGAGCTGGG - Intergenic
1149600509 17:57890352-57890374 CAGAGCTGGCTCTGTGACCTTGG + Intronic
1150445261 17:65223577-65223599 CAGGGCTACCTCCTTCAGCCCGG + Intronic
1151513733 17:74578904-74578926 CAGAGCTAGAACTGTGAGCTGGG - Intergenic
1153376502 18:4386582-4386604 CTGAGCCAGCTCTTTGACCTTGG - Intronic
1155110207 18:22707438-22707460 CAGAGCTCACTCTTTGAACATGG - Intergenic
1157282781 18:46357053-46357075 CAGATCTACCTTTCTGAGGTAGG + Intronic
1158350367 18:56559036-56559058 CAAAGCTAGCTCTATGACCTTGG + Intergenic
1168703815 19:58456773-58456795 CAGTGTTACCTCTTTGAGGATGG - Exonic
1168706331 19:58472339-58472361 CAGTGCTACCTCTTTGGGGATGG - Exonic
926146049 2:10397672-10397694 CTGAGCTAACTCCGTGAGCTCGG + Intronic
926813241 2:16775058-16775080 CAGAGTTAGATCTCTGAGCTAGG + Intergenic
926904666 2:17794554-17794576 AAGAGCTTCCTCTCTGAGGTTGG - Intronic
928044623 2:27916781-27916803 CAGAGAAACCACTTTTAGCTTGG - Intronic
931231015 2:60375003-60375025 TAGAGCTACCTCTTTGGTTTTGG - Intergenic
940255568 2:151724634-151724656 CACAGCTGCCTCTTTGGGCAGGG + Intronic
940997832 2:160169378-160169400 CAAAGATACCTTTTTGAGTTTGG + Intronic
947388283 2:229614567-229614589 CAGAGCTACCTCCTTGTCCCAGG - Intronic
948166041 2:235863544-235863566 TACAGCCTCCTCTTTGAGCTAGG + Intronic
1170781661 20:19431000-19431022 CAGAGATACCTGTCTGTGCTGGG - Intronic
1171517105 20:25746598-25746620 CACAGCTGCCCCTGTGAGCTGGG + Intergenic
1172935207 20:38615382-38615404 AAGAGCTACCTCATTGGGGTGGG - Intronic
1173274842 20:41571228-41571250 CACAGATACCTCTTTGTTCTTGG - Intronic
1174170320 20:48613738-48613760 CAGAGCTACCTGTATCAGCTGGG + Intergenic
1177829861 21:26125871-26125893 CAGAGCTGCCTATGTGACCTGGG + Intronic
1179336480 21:40461491-40461513 CAGCTCTGCCTCTTAGAGCTGGG - Intronic
1180890593 22:19285322-19285344 CAGAGCTCCCTCTTTAGGCTAGG - Intronic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1183362296 22:37389041-37389063 AAGAGCTTCCTCTCAGAGCTTGG + Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
949905534 3:8855505-8855527 CAGAGCTAACTCAGAGAGCTAGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
959911674 3:111770714-111770736 CAGTTCTACCTCTGTGAGGTGGG - Intronic
960045765 3:113196355-113196377 CAGAGTTGCCTCTATAAGCTTGG - Intergenic
961074040 3:123964960-123964982 CAGGACTAGCCCTTTGAGCTTGG + Intergenic
961309585 3:125987172-125987194 CAGGACTAGCCCTTTGAGCTTGG - Intergenic
965620814 3:170640876-170640898 CACAGCTACCCCTTTGTGCCTGG + Intronic
970048186 4:11879784-11879806 TAGAGATATTTCTTTGAGCTAGG - Intergenic
970196806 4:13559252-13559274 CAGAGCTAGCTGTTTTAGCAGGG - Intergenic
976118832 4:81758044-81758066 GAGAGCCACATCTTAGAGCTAGG + Intronic
979197152 4:117933470-117933492 CAGAGCTATCTATGTTAGCTCGG - Intergenic
980222628 4:129939411-129939433 CAGAGCTACATCTTGAAACTGGG - Intergenic
991493181 5:67203220-67203242 CACAGATACCTATTTGATCTTGG + Intergenic
991508664 5:67352718-67352740 CACAGCTTCCTCTTTGCCCTTGG - Intergenic
993819245 5:92593570-92593592 CATAGCTACTTCTCTGATCTTGG + Intergenic
994436780 5:99745605-99745627 CAGATCTACCCTTTTGACCTGGG - Intergenic
994787954 5:104187848-104187870 CAGGGGCACCTGTTTGAGCTGGG + Intergenic
997286878 5:132686311-132686333 CAGAGCTTCCTTATGGAGCTAGG + Intergenic
997435342 5:133870167-133870189 CTGAGCTCCTTCTGTGAGCTTGG + Intergenic
1001575523 5:172761206-172761228 CAAAACTACTTCTCTGAGCTAGG - Intergenic
1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG + Intronic
1011389737 6:86838632-86838654 CAGAGCTACGTCTTGAAACTGGG + Intergenic
1011769594 6:90661018-90661040 CAGAGCCACCCCTTTGCTCTGGG + Intergenic
1015734799 6:136387480-136387502 CAGATCTACGTCTATGCGCTAGG + Intronic
1015977551 6:138806195-138806217 CTGAGCTACCATTTTAAGCTGGG - Intronic
1019226186 6:170511832-170511854 ATGTGCAACCTCTTTGAGCTGGG + Intergenic
1020267422 7:6570483-6570505 CGGAGCTATCTTCTTGAGCTGGG + Intergenic
1022197857 7:28086365-28086387 CAGAGCTTCCTCTTTAATTTGGG - Intronic
1022847676 7:34227268-34227290 CAGAGGAACTTATTTGAGCTGGG - Intergenic
1023740821 7:43279066-43279088 CAGTGTTATTTCTTTGAGCTGGG + Intronic
1024361895 7:48476891-48476913 CAGAGCTACATCTTGAAACTCGG + Intronic
1024958868 7:54954460-54954482 CAGAGCTACCTCTAAAGGCTGGG + Intergenic
1026119414 7:67523847-67523869 CAGTGCTTCCTCCTTGGGCTGGG + Intergenic
1026892708 7:73991920-73991942 CAGGGCTTCCTCTGTAAGCTAGG + Intergenic
1026942032 7:74292767-74292789 CACAGCCACCTCTTTGTGCCAGG - Intronic
1030032098 7:105378945-105378967 CAAAACTACATCTTTGAGCCTGG + Intronic
1031967222 7:128035278-128035300 CAGAGCTACATATCTGAGATGGG - Intronic
1033045197 7:137955682-137955704 CAGATCTGCCTCTTTGAGGTGGG - Intronic
1033786397 7:144736512-144736534 CAAAGATCCCTCTTTGATCTGGG + Intronic
1036791437 8:11723619-11723641 CAGAGCTAGCTCTGCCAGCTGGG + Intronic
1037690564 8:21178015-21178037 CACTGCTACCTTGTTGAGCTTGG + Intergenic
1041324299 8:56648656-56648678 CTGAGCTACCTCATTTAGCAAGG - Intergenic
1043706895 8:83361397-83361419 CAGAGCTACATCTTGAAACTGGG - Intergenic
1051095972 9:13465529-13465551 CAGAGCTAGATCTTGGACCTGGG - Intergenic
1055729536 9:79266258-79266280 AAGAGCTCCCTCTATGAGCCAGG + Intergenic
1058710741 9:107676932-107676954 CACATCCATCTCTTTGAGCTTGG + Intergenic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic
1187446021 X:19361954-19361976 CAGAGCTACCTCTTGGAATGTGG - Intronic
1189124872 X:38435683-38435705 TAGAGCTACCACTTTGTGCTAGG - Intronic
1193610751 X:83629314-83629336 CAGAGATTCTTCTTTAAGCTTGG + Intergenic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic