ID: 1181963254

View in Genome Browser
Species Human (GRCh38)
Location 22:26638295-26638317
Sequence CTCAGGTCCTTGGGCAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181963247_1181963254 24 Left 1181963247 22:26638248-26638270 CCTTCACACTTTAGTATTAACAA No data
Right 1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG No data
1181963246_1181963254 25 Left 1181963246 22:26638247-26638269 CCCTTCACACTTTAGTATTAACA No data
Right 1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181963254 Original CRISPR CTCAGGTCCTTGGGCAAAGC GGG Intergenic
No off target data available for this crispr