ID: 1181963340

View in Genome Browser
Species Human (GRCh38)
Location 22:26638802-26638824
Sequence CTCTTTGCCCAGAGAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181963333_1181963340 -9 Left 1181963333 22:26638788-26638810 CCCAAACCAGCAACCTCTTTGCC No data
Right 1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG No data
1181963334_1181963340 -10 Left 1181963334 22:26638789-26638811 CCAAACCAGCAACCTCTTTGCCC No data
Right 1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG No data
1181963332_1181963340 5 Left 1181963332 22:26638774-26638796 CCAGGGCTGTGGATCCCAAACCA No data
Right 1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG No data
1181963328_1181963340 27 Left 1181963328 22:26638752-26638774 CCGACAGGACTGAACACAGGGTC No data
Right 1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181963340 Original CRISPR CTCTTTGCCCAGAGAGGGAA GGG Intergenic
No off target data available for this crispr