ID: 1181964368

View in Genome Browser
Species Human (GRCh38)
Location 22:26646262-26646284
Sequence TCCAGAAGGCAGGTAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181964368_1181964375 16 Left 1181964368 22:26646262-26646284 CCAGTCCCTACCTGCCTTCTGGA No data
Right 1181964375 22:26646301-26646323 ATTCTCTGCCTCCCTCCTGCAGG No data
1181964368_1181964377 24 Left 1181964368 22:26646262-26646284 CCAGTCCCTACCTGCCTTCTGGA No data
Right 1181964377 22:26646309-26646331 CCTCCCTCCTGCAGGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181964368 Original CRISPR TCCAGAAGGCAGGTAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr