ID: 1181966355

View in Genome Browser
Species Human (GRCh38)
Location 22:26658762-26658784
Sequence CCCTCCCGCCGCAGCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181966355_1181966364 -3 Left 1181966355 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG No data
Right 1181966364 22:26658782-26658804 GGGGAGGAAGTATGAGAGGGAGG No data
1181966355_1181966365 16 Left 1181966355 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG No data
Right 1181966365 22:26658801-26658823 GAGGACTGCGAGAGAACTTGAGG No data
1181966355_1181966366 17 Left 1181966355 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG No data
Right 1181966366 22:26658802-26658824 AGGACTGCGAGAGAACTTGAGGG No data
1181966355_1181966367 22 Left 1181966355 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG No data
Right 1181966367 22:26658807-26658829 TGCGAGAGAACTTGAGGGAACGG No data
1181966355_1181966363 -6 Left 1181966355 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG No data
Right 1181966363 22:26658779-26658801 GGAGGGGAGGAAGTATGAGAGGG No data
1181966355_1181966362 -7 Left 1181966355 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG No data
Right 1181966362 22:26658778-26658800 GGGAGGGGAGGAAGTATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181966355 Original CRISPR CCCTCCCGCCGCAGCAGGTG GGG (reversed) Intergenic