ID: 1181966973

View in Genome Browser
Species Human (GRCh38)
Location 22:26663555-26663577
Sequence GTGGCTTTCCCGACTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181966967_1181966973 1 Left 1181966967 22:26663531-26663553 CCTCTGGGTTCCAGTTCCCCAAT No data
Right 1181966973 22:26663555-26663577 GTGGCTTTCCCGACTGACCTTGG No data
1181966969_1181966973 -9 Left 1181966969 22:26663541-26663563 CCAGTTCCCCAATCGTGGCTTTC No data
Right 1181966973 22:26663555-26663577 GTGGCTTTCCCGACTGACCTTGG No data
1181966966_1181966973 2 Left 1181966966 22:26663530-26663552 CCCTCTGGGTTCCAGTTCCCCAA No data
Right 1181966973 22:26663555-26663577 GTGGCTTTCCCGACTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181966973 Original CRISPR GTGGCTTTCCCGACTGACCT TGG Intergenic
No off target data available for this crispr