ID: 1181967940

View in Genome Browser
Species Human (GRCh38)
Location 22:26669687-26669709
Sequence CAGAATTCCCGCCCCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181967935_1181967940 11 Left 1181967935 22:26669653-26669675 CCGCAAACATGGAAAGTCAGAGC 0: 1
1: 0
2: 0
3: 26
4: 209
Right 1181967940 22:26669687-26669709 CAGAATTCCCGCCCCCACCCAGG 0: 1
1: 0
2: 2
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181967940 Original CRISPR CAGAATTCCCGCCCCCACCC AGG Intergenic
900191981 1:1355835-1355857 CAGACATCCCTCCCCCACCAGGG - Intronic
900438835 1:2643480-2643502 CAGGCTTCCCGCCCCCTGCCAGG + Intronic
901323532 1:8353572-8353594 CAGAACACCCGCCCTCAGCCTGG + Exonic
901935116 1:12621437-12621459 CAGAATCCCAGGCCCCACCCTGG + Intergenic
903191145 1:21656792-21656814 CAGAATACCTGCCCCCACTCAGG + Intronic
903806021 1:26006125-26006147 CACCACTCCTGCCCCCACCCTGG - Intergenic
903813107 1:26045812-26045834 CAAAATTCCCGCCCGTCCCCAGG + Intronic
903831629 1:26178605-26178627 CTGAATTCCTGCCCTTACCCGGG - Intronic
904171134 1:28592755-28592777 CAGAAGTCCCTCCCGCGCCCCGG - Intronic
905308347 1:37033937-37033959 CCTCATTCCCGCCCCCTCCCGGG + Intronic
905909180 1:41642080-41642102 AGGATTTCCTGCCCCCACCCTGG + Intronic
906203889 1:43976670-43976692 ATGGATTCCCGCCACCACCCTGG - Intronic
906946974 1:50302909-50302931 CAAAATTCAAGACCCCACCCTGG + Intergenic
909761818 1:79297988-79298010 CAGAAAACCCACTCCCACCCTGG - Intergenic
912430249 1:109625077-109625099 CAGAATCCCCACCCCAAGCCTGG + Intronic
913113859 1:115679375-115679397 CACAGTACCCGCCCCCACCCTGG + Intronic
915084820 1:153379004-153379026 CAGGATTCACATCCCCACCCAGG - Intergenic
915327447 1:155087608-155087630 CAGAATTCCCTCTCCTACTCAGG - Intergenic
915561931 1:156692707-156692729 CAGCACCCCCGCCCCCAGCCAGG - Intergenic
916069943 1:161164046-161164068 CAGGGTTCCCGCCCACACTCTGG - Intronic
919822216 1:201480721-201480743 CAGATTCCCAGGCCCCACCCAGG + Intergenic
920033245 1:203049639-203049661 CCCCACTCCCGCCCCCACCCCGG + Intronic
921440706 1:215182575-215182597 CAGCATTCCCCACCCTACCCAGG + Intronic
922486170 1:225974838-225974860 CAAAATCCCAGCCCACACCCTGG - Intergenic
922881929 1:228987739-228987761 CAGACTGCCCACCCCTACCCTGG + Intergenic
924370841 1:243348343-243348365 AAGAATTCCCGCCCCAGGCCGGG - Intronic
1064158863 10:12926095-12926117 CAGTATTCCAGTCCCTACCCAGG - Intronic
1064502087 10:15984590-15984612 AAGAATTCCCTCCCGAACCCAGG + Intergenic
1065829869 10:29604992-29605014 CAGTATTCCCGCCCTTATCCTGG - Intronic
1067694098 10:48523256-48523278 CAGATTCCCAGGCCCCACCCTGG - Intronic
1067804388 10:49382984-49383006 CACACCTCCCACCCCCACCCAGG + Intronic
1068598000 10:58924676-58924698 CAGAATTCCCTCCTCCTCCAGGG - Intergenic
1069415345 10:68195681-68195703 CAGAATCCCAGGCCCCACTCTGG + Intronic
1069994161 10:72332441-72332463 CGAAATTCCCGGCCCCAGCCTGG - Intergenic
1070485060 10:76922404-76922426 AAGAAACTCCGCCCCCACCCTGG + Intronic
1076550290 10:131273576-131273598 CAGCTTTCCCGCCTCCATCCAGG + Intronic
1080862216 11:36159830-36159852 CAGAATAACCACCCCTACCCTGG + Intronic
1081390913 11:42527641-42527663 CTGAATTCCAGCCCCCACTTTGG - Intergenic
1081679302 11:44990464-44990486 CAGACTCCCAGGCCCCACCCTGG + Intergenic
1083168379 11:60906257-60906279 CCCCATTCCCGCCTCCACCCCGG + Intronic
1083200989 11:61121008-61121030 CAGACTCCCAGGCCCCACCCTGG + Intronic
1084419749 11:69054347-69054369 CAGGATGCCCCCACCCACCCGGG - Intronic
1084697035 11:70761877-70761899 CAGAATCCCAGACTCCACCCTGG - Intronic
1085044205 11:73343826-73343848 CAGAATTACAGCCCCCACTGGGG - Intronic
1085699642 11:78734707-78734729 CAGAATTCCAGCTTCCTCCCTGG + Intronic
1086494372 11:87386931-87386953 CAGAAGCCCCTCCCCCAGCCAGG - Intergenic
1088724373 11:112621261-112621283 CAGAAGCCCTGGCCCCACCCTGG + Intergenic
1089384653 11:118059852-118059874 TAGAATTCCGGCTCCCACGCCGG + Intergenic
1089663483 11:120001289-120001311 CAGCCTTCCCACCACCACCCGGG - Intergenic
1091952272 12:4604340-4604362 CAGAATCCCTGCCCCTCCCCAGG + Intronic
1092598215 12:10030656-10030678 CGGAAGTCCCGCCCCCTTCCAGG - Exonic
1095374133 12:41505865-41505887 CAGAATCCCTGGCACCACCCTGG - Intronic
1095416399 12:41982011-41982033 CAGAATTTCAGGCCCCTCCCAGG - Intergenic
1095555114 12:43493555-43493577 CAGAATCTCAGGCCCCACCCTGG + Intronic
1096694594 12:53340536-53340558 CAGCATCCCTACCCCCACCCAGG + Intronic
1100571781 12:95849742-95849764 CAGTAGTCCCTCCCCCACCCAGG - Intergenic
1102634718 12:114312800-114312822 CTGAATCCCAGGCCCCACCCTGG - Intergenic
1102748624 12:115272279-115272301 CAGAATTGCAGCCCACACCAGGG - Intergenic
1103603121 12:122066864-122066886 CATAATTCTCCCCACCACCCTGG - Intergenic
1104065885 12:125305434-125305456 CAGCCTTCCCCCCCCTACCCTGG - Intronic
1106624668 13:31408445-31408467 CAGAATCTCAGGCCCCACCCAGG + Intergenic
1107610389 13:42107229-42107251 CAGAATGCACACCCCCGCCCTGG - Intronic
1112303699 13:98253838-98253860 CAGAAATTCTGCCTCCACCCAGG - Intronic
1112440101 13:99418832-99418854 CTGAATTCTGGCCCCCACCACGG - Intergenic
1113561069 13:111282109-111282131 CACAATTCCCTCCCCCATGCAGG + Intronic
1113725052 13:112592432-112592454 GAGAGTGCCAGCCCCCACCCTGG + Intergenic
1119472124 14:74906841-74906863 CAGAATTATGGCCACCACCCAGG - Exonic
1119883616 14:78122096-78122118 CAGAATCTCGGACCCCACCCTGG + Intergenic
1121104917 14:91273491-91273513 CAAAATGGCCGCCCCCACCTCGG - Exonic
1122419114 14:101564222-101564244 CCGAATCCCCGCCCCAGCCCTGG - Intergenic
1122738183 14:103855638-103855660 CAGAGTCCCCACCCCCACACTGG - Intergenic
1122797646 14:104214043-104214065 CAGAATAACCGCCCCATCCCAGG + Intergenic
1123105740 14:105840327-105840349 CAGAGTCCCCGTCCCAACCCTGG + Intergenic
1123117356 14:105900710-105900732 CACAAGCCCAGCCCCCACCCAGG - Intergenic
1123119447 14:105909979-105910001 CACAAGCCCAGCCCCCACCCAGG - Intergenic
1123404365 15:20011225-20011247 CACAAGCCCAGCCCCCACCCAGG - Intergenic
1123513700 15:21017872-21017894 CACAAGCCCAGCCCCCACCCAGG - Intergenic
1124232743 15:27959634-27959656 GAGACTTCCAGCCCGCACCCAGG - Intronic
1124348832 15:28940766-28940788 TACATTTCCCGCCCCCAACCCGG - Intronic
1125103269 15:35940566-35940588 AAGAATCCCTGCCCCCACCTAGG - Intergenic
1125529597 15:40404161-40404183 GAGACTGCCCACCCCCACCCCGG + Intergenic
1128315573 15:66657273-66657295 CAGATTCCCAGGCCCCACCCAGG - Intronic
1129911028 15:79226488-79226510 CAGAATCCCTGGCCCCACTCTGG + Intergenic
1131368589 15:91861004-91861026 CAGCCTTCCCGCCCCCAGTCTGG + Intronic
1132201523 15:99957472-99957494 CAGAATCCCGGCTCCCGCCCGGG - Intergenic
1132559992 16:589279-589301 CGGAAGTCCCGCCCCTGCCCCGG + Intergenic
1132614157 16:832049-832071 CAGAATCCCGGGCCCCAGCCGGG - Intergenic
1132862420 16:2078174-2078196 CAGGATCCTAGCCCCCACCCAGG - Intronic
1132887718 16:2189819-2189841 CAGCATTCCCCCCACCTCCCAGG - Intronic
1134441780 16:14302885-14302907 CCGCGTCCCCGCCCCCACCCCGG + Intergenic
1135061114 16:19272147-19272169 CAGGATTCCAGCCCACACCTTGG + Intergenic
1137028540 16:35501317-35501339 CAGCAATCCCGCGCCCACCCAGG + Intergenic
1138687482 16:58738478-58738500 CAGAAATGCCACCCCAACCCTGG - Intergenic
1139432307 16:66917796-66917818 CGGAATTTCCGCCCCTTCCCAGG + Intronic
1139470992 16:67178145-67178167 CCGAAGCCCCGCCCCCACCCCGG + Intronic
1140057625 16:71539028-71539050 CAGAACTCCAGCCCCCATACTGG - Intronic
1140328666 16:74030551-74030573 CAGCCTTCCCTCCCCCACCCTGG - Intergenic
1142476849 17:193850-193872 CAGAATACTGGGCCCCACCCTGG - Intergenic
1142799346 17:2335859-2335881 CAGAATTCCTGCCACCCCGCTGG - Intronic
1142833809 17:2569607-2569629 CAGAATTCACCTCCCAACCCAGG - Intergenic
1142892826 17:2956414-2956436 CAGAATTCCCAGACCCGCCCTGG - Intronic
1142996710 17:3764788-3764810 CAAACTTCTTGCCCCCACCCAGG + Intronic
1143015709 17:3890189-3890211 CGCAGCTCCCGCCCCCACCCGGG + Intronic
1143168242 17:4909997-4910019 CAGCGTTCCCGCCCCGCCCCAGG + Intergenic
1147261804 17:39213254-39213276 CCGGATTCCAGCCCCCAGCCAGG + Intronic
1147585661 17:41652815-41652837 CAGAATTCCCACGCCCACCCTGG + Intergenic
1147840322 17:43366971-43366993 CAGCATTCCAGCACCCACCCAGG - Intergenic
1151218079 17:72591605-72591627 CAGAAAGCCCGTCCACACCCTGG + Intergenic
1152152665 17:78612277-78612299 CAGAGGTCCCTCCTCCACCCGGG - Intergenic
1152223294 17:79081110-79081132 CACAGTACCCGCCCCCACCACGG - Intronic
1152285943 17:79413494-79413516 CAGCATCCCCGCTCCCACCCAGG + Intronic
1152377739 17:79927466-79927488 CGTGATGCCCGCCCCCACCCGGG - Intergenic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1153835700 18:8962250-8962272 CAGATTCCCCGCACCCACCAAGG - Intergenic
1154330382 18:13424630-13424652 CAGTATTCCCATCCCCATCCAGG - Intronic
1155990135 18:32271561-32271583 CAGATTCCCAGGCCCCACCCTGG - Intronic
1159827056 18:73226338-73226360 GAAAATTCCCACCCACACCCTGG + Intronic
1159948064 18:74458140-74458162 CAGCATCCCCCACCCCACCCAGG + Intergenic
1160525071 18:79531016-79531038 CAGCATTCCCCTCCCCACCCGGG + Intergenic
1160786222 19:901241-901263 CAGAATCCCCACCCCACCCCTGG - Intronic
1161170575 19:2810561-2810583 CAGAGCTCCGACCCCCACCCGGG - Intronic
1162215325 19:9129182-9129204 CAAAATTCAGGCCCCCAACCGGG + Intergenic
1165071954 19:33260942-33260964 CAGACTTCCCGCTGCCCCCCCGG - Intergenic
1165197948 19:34120511-34120533 CAGGCTTCCCGCCACCACGCTGG - Intergenic
1165428389 19:35757831-35757853 CAGAAGTCCTGTCCCGACCCCGG - Intronic
1165454166 19:35901126-35901148 CAGAAATCCAGGCCCCAGCCAGG - Intronic
1166199339 19:41226340-41226362 CAGGCTCCCCGCCCCCACTCGGG + Intronic
1167377550 19:49119838-49119860 CAGATTTCACACCCCAACCCCGG + Intronic
1167471390 19:49677955-49677977 CAGAATTCTCCCCCTCGCCCAGG + Intronic
925646986 2:6045429-6045451 CAGAACTACCGCCCCATCCCAGG + Intergenic
928386508 2:30872946-30872968 CAGTCTTCCGGCCCCCTCCCTGG + Intergenic
929057464 2:37890929-37890951 CAGACTGCCAGCCCCTACCCAGG + Intergenic
929688569 2:44055848-44055870 GAGAAATCCCGCCCCCTGCCTGG - Intergenic
929841010 2:45463016-45463038 GAGATTTCCCCCCCCCCCCCCGG - Intronic
929882922 2:45852898-45852920 CAGAATCTCAGCCCCCATCCTGG - Intronic
931009334 2:57890397-57890419 CACAATCCCAGGCCCCACCCTGG - Intergenic
937943841 2:127312885-127312907 CACAACCTCCGCCCCCACCCTGG - Intronic
938301122 2:130213697-130213719 CAGGATCCCCGCCCCGGCCCCGG + Intergenic
938455594 2:131460770-131460792 CAGGATCCCCGCCCCGGCCCCGG - Intergenic
939930833 2:148231026-148231048 CAGCACTCCCTTCCCCACCCTGG + Intronic
943471014 2:188293001-188293023 CAGAGTTCCCTCCCGCACACAGG - Exonic
946117799 2:217478930-217478952 CAGACTTCCCAACCCCACCCAGG + Intronic
946666506 2:222055272-222055294 CAGTTTTCTCACCCCCACCCTGG - Intergenic
946745962 2:222846225-222846247 CAGAATCTCAGGCCCCACCCAGG - Intergenic
946787113 2:223259126-223259148 CAGACTCCCCTCCCCCAGCCAGG + Intergenic
946790587 2:223297168-223297190 CAACATCCCCTCCCCCACCCAGG + Intergenic
947566823 2:231199380-231199402 GAAAATTCCTGCCTCCACCCTGG - Intronic
948492306 2:238321043-238321065 CAGAACTCTCGCCCCGACCCCGG - Intronic
1172689049 20:36778034-36778056 CAGGACTCCCACCCCCTCCCTGG + Exonic
1173021485 20:39271326-39271348 CAGAATCCACGCCCACATCCAGG - Intergenic
1173527638 20:43745151-43745173 CATAATCCCCTACCCCACCCCGG - Intergenic
1174463580 20:50700014-50700036 CAGCATCCCAGGCCCCACCCCGG + Intergenic
1175665147 20:60852354-60852376 CAGAATTCCAGCTCTAACCCAGG + Intergenic
1179011791 21:37562143-37562165 CAGTATCCACGCTCCCACCCTGG + Intergenic
1180211253 21:46296523-46296545 CAGAGCTCCCGCCTCCGCCCTGG - Intronic
1180228710 21:46413419-46413441 CAGAATACCCGCCTCTGCCCAGG - Intronic
1180698952 22:17771418-17771440 CCCACTTCCCACCCCCACCCTGG + Intronic
1180699497 22:17773945-17773967 CGGAATCCCCGCCCACACCGTGG - Exonic
1180793874 22:18592363-18592385 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1181174409 22:21027652-21027674 TAGAATTCCCTGCCCCGCCCTGG - Exonic
1181227866 22:21402957-21402979 TAGGATTCCTTCCCCCACCCTGG + Intergenic
1181250786 22:21531882-21531904 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1181967940 22:26669687-26669709 CAGAATTCCCGCCCCCACCCAGG + Intergenic
1182151201 22:28028296-28028318 CACAATCTCCGCCCCCAGCCAGG - Intronic
1182681217 22:32081398-32081420 GAGAAACCCCACCCCCACCCAGG - Intronic
1183354415 22:37350681-37350703 CAGAGCTGCCGCCCCCACCCTGG - Intergenic
1183487439 22:38097178-38097200 CAGAACTCCCGTTCCCCCCCAGG - Exonic
1184465694 22:44668177-44668199 CAGAGTCCCTGGCCCCACCCCGG - Intergenic
1184656367 22:45944027-45944049 CAGAGTCCCAGCCCCCACCTCGG + Intronic
1184670536 22:46010294-46010316 CAGCATTCCCCACCCCAGCCTGG + Intergenic
1184742486 22:46437193-46437215 CAGAAATCCTTCTCCCACCCAGG + Intronic
1185409359 22:50674236-50674258 CACACCTCCCGCCCCCACCCGGG + Intergenic
950289933 3:11775350-11775372 CACATTCCCCGCCACCACCCTGG + Intergenic
950379683 3:12601032-12601054 CAGAATCCACCTCCCCACCCTGG - Intronic
954220681 3:49151824-49151846 CAGTGACCCCGCCCCCACCCAGG - Intergenic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954783368 3:53075994-53076016 CTGATTTCCATCCCCCACCCAGG - Intronic
955911372 3:63863273-63863295 CGAAATTCCCGCCCCGTCCCTGG + Intronic
957792466 3:84958933-84958955 CGGAGGCCCCGCCCCCACCCCGG - Intergenic
961387869 3:126534444-126534466 CAGCATCCCTGTCCCCACCCAGG + Intronic
961387906 3:126534730-126534752 CAGCATCCCTGTCCCCACCCAGG + Intronic
966429340 3:179814964-179814986 TTTAATTCCTGCCCCCACCCTGG + Intronic
968009810 3:195266770-195266792 CAGACTTCCAGGCCCCACCCAGG + Intronic
968046971 3:195630022-195630044 CAGAATGCCCCATCCCACCCAGG + Intergenic
968307682 3:197660022-197660044 CAGAATGCCCCATCCCACCCAGG - Intergenic
969438020 4:7199668-7199690 CAGAATGGCCCGCCCCACCCAGG - Intronic
970572406 4:17395750-17395772 CAGGATTCCAGCCCACCCCCAGG + Intergenic
978117727 4:105041875-105041897 CAGAATTCCTTTCCCCATCCTGG + Intergenic
979487397 4:121284152-121284174 GAGAATTCCAGACCCCACCATGG + Intergenic
981436906 4:144734859-144734881 CAGAAGTCCCCCTCCCAGCCTGG - Exonic
981655936 4:147112365-147112387 CAGATGTCCCTCCCCCAGCCAGG - Intergenic
986115363 5:4768537-4768559 CAGACTTCCGGCCTCCACACTGG + Intergenic
987949796 5:24660452-24660474 CAGACATCCCTCCCCCAGCCAGG + Intergenic
990484870 5:56248295-56248317 CAGAATCTCTGCCCCTACCCTGG - Intergenic
992087901 5:73294555-73294577 CGCAGCTCCCGCCCCCACCCAGG + Intergenic
994725885 5:103434498-103434520 CAGAGCTCCCGCCCCCGCCATGG - Intergenic
997079401 5:130721016-130721038 AGGAATGCCTGCCCCCACCCTGG + Intergenic
997626038 5:135331102-135331124 CAGAATTCCCCCTCCCATTCAGG - Intronic
998401811 5:141852334-141852356 CAGAGACCCCACCCCCACCCCGG - Intergenic
999417294 5:151409626-151409648 CAGAATCTCAGGCCCCACCCTGG + Intergenic
999609336 5:153352180-153352202 CAGAATTCTGGGCCCCATCCCGG - Intergenic
1000730435 5:164828373-164828395 CAACATTCCCTCCCCAACCCAGG + Intergenic
1001388568 5:171359955-171359977 CTGGATTCGCGTCCCCACCCAGG + Intergenic
1002451658 5:179322421-179322443 CAGTTCTCCCTCCCCCACCCAGG + Intronic
1003170233 6:3715782-3715804 CAGAACCCCTACCCCCACCCAGG - Intergenic
1003176723 6:3757530-3757552 CAGAATCTCAGGCCCCACCCAGG - Intergenic
1004105591 6:12664755-12664777 CAGCATTCCTGCCCTCCCCCTGG - Intergenic
1006386661 6:33734796-33734818 CAGAACTCCCGCCCTCACCCAGG - Intronic
1011514317 6:88135798-88135820 TAGAGTCCCCACCCCCACCCCGG + Intergenic
1013390247 6:109679260-109679282 CAGACTCCCCTCCCCCAGCCAGG - Intronic
1015129619 6:129794646-129794668 CCTAATTCCAGTCCCCACCCTGG - Intergenic
1015305001 6:131697419-131697441 CCCCCTTCCCGCCCCCACCCTGG - Intronic
1017914249 6:158819278-158819300 CAGAACCCCCGTCCCGACCCCGG + Intronic
1018802330 6:167233718-167233740 CTGACTTGCGGCCCCCACCCAGG + Intergenic
1019292850 7:258775-258797 CAGCCTTCCCCACCCCACCCCGG + Intronic
1019758556 7:2791396-2791418 AAGATTTCCATCCCCCACCCCGG + Intronic
1020007574 7:4790637-4790659 CAGAGATTCAGCCCCCACCCAGG - Intronic
1020097383 7:5376595-5376617 GGGAATCCCAGCCCCCACCCAGG + Intronic
1031526400 7:122826182-122826204 CAGAAATCCCACCCCAACCCAGG + Intronic
1031823684 7:126535393-126535415 CAGAATTCTTGGCTCCACCCAGG + Intronic
1032167644 7:129558262-129558284 CCGCCTCCCCGCCCCCACCCCGG + Intergenic
1037875669 8:22546521-22546543 CAGAATCCACTCCCCAACCCTGG + Intronic
1038615076 8:29086211-29086233 CAAAACCCCAGCCCCCACCCTGG - Intronic
1039475169 8:37835779-37835801 CTGAATTCCCCGCCCCGCCCAGG + Intronic
1040296627 8:46152293-46152315 CGGGATTCCAACCCCCACCCGGG + Intergenic
1040328440 8:46374089-46374111 CAGAGCTCTAGCCCCCACCCGGG + Intergenic
1041066692 8:54089490-54089512 CAAAGATCCCGCCCCCCCCCAGG - Intronic
1041185804 8:55299710-55299732 CAGAATTCCAGCTGTCACCCTGG - Intronic
1042696651 8:71561081-71561103 CAGCACTCCCTCCTCCACCCCGG + Intronic
1044540612 8:93404788-93404810 CACAATGCCCGCCCCTACCTTGG - Intergenic
1045568294 8:103343576-103343598 CAGGAATCCCACACCCACCCTGG - Intergenic
1047241682 8:123095745-123095767 TACAATTCCCGCCCTAACCCTGG + Intronic
1047883594 8:129223253-129223275 CAGAAATCCAGGACCCACCCTGG - Intergenic
1049360477 8:142210432-142210454 CAGAACACCTGCTCCCACCCAGG + Intergenic
1057013303 9:91627934-91627956 CTGAACTGCCCCCCCCACCCCGG + Intronic
1057819182 9:98318214-98318236 CAGCATCCCAGGCCCCACCCGGG - Intronic
1057880159 9:98787114-98787136 CGGAAATCCAGCCCCCACCAAGG - Intronic
1058147791 9:101430857-101430879 CCGATTTCCAGCCCTCACCCAGG - Exonic
1061165481 9:128919777-128919799 CCCCACTCCCGCCCCCACCCTGG + Intergenic
1061741590 9:132710506-132710528 CAGAGTCCCCCCACCCACCCAGG - Intergenic
1061837138 9:133336802-133336824 TACGATTCCCTCCCCCACCCCGG + Intergenic
1186504894 X:10083375-10083397 GAGAATACCCGCCCTCCCCCTGG + Intronic
1186842010 X:13493882-13493904 CAGGAATCCCTCCCCTACCCAGG + Intergenic
1188203446 X:27321714-27321736 CAGAACTCCCAACCCCAACCAGG + Intergenic
1190622261 X:52299135-52299157 CAGACGTCCCTCCCCCAGCCAGG - Intergenic
1192224105 X:69216680-69216702 CAGAAGTCCTGCCCCCTCTCTGG - Intergenic
1197497812 X:127207565-127207587 CAAGATCCCCTCCCCCACCCAGG - Intergenic
1197537288 X:127706675-127706697 CAACATTTCCTCCCCCACCCAGG + Intergenic
1200810478 Y:7479538-7479560 CAGACGCCCCTCCCCCACCCAGG + Intergenic
1202115181 Y:21465201-21465223 CAGAAATCCCGCCAAAACCCAGG + Intergenic