ID: 1181967940

View in Genome Browser
Species Human (GRCh38)
Location 22:26669687-26669709
Sequence CAGAATTCCCGCCCCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181967935_1181967940 11 Left 1181967935 22:26669653-26669675 CCGCAAACATGGAAAGTCAGAGC 0: 1
1: 0
2: 0
3: 26
4: 209
Right 1181967940 22:26669687-26669709 CAGAATTCCCGCCCCCACCCAGG 0: 1
1: 0
2: 2
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181967940 Original CRISPR CAGAATTCCCGCCCCCACCC AGG Intergenic