ID: 1181969658

View in Genome Browser
Species Human (GRCh38)
Location 22:26680619-26680641
Sequence GAATGAAACAAGAGTCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181969654_1181969658 27 Left 1181969654 22:26680569-26680591 CCAGTACTGCACTTGGCACAGAG No data
Right 1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG No data
1181969653_1181969658 28 Left 1181969653 22:26680568-26680590 CCCAGTACTGCACTTGGCACAGA No data
Right 1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181969658 Original CRISPR GAATGAAACAAGAGTCAGTT GGG Intergenic
No off target data available for this crispr