ID: 1181972531

View in Genome Browser
Species Human (GRCh38)
Location 22:26702826-26702848
Sequence GCACACTGCCTAGAGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181972531_1181972532 5 Left 1181972531 22:26702826-26702848 CCAGCTTTCTCTAGGCAGTGTGC No data
Right 1181972532 22:26702854-26702876 CTTGAAACCCCATCAAATTGAGG No data
1181972531_1181972536 18 Left 1181972531 22:26702826-26702848 CCAGCTTTCTCTAGGCAGTGTGC No data
Right 1181972536 22:26702867-26702889 CAAATTGAGGCACTGTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181972531 Original CRISPR GCACACTGCCTAGAGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr