ID: 1181973449

View in Genome Browser
Species Human (GRCh38)
Location 22:26711259-26711281
Sequence CAATGAGCTCAGTCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181973442_1181973449 15 Left 1181973442 22:26711221-26711243 CCAATGCAGGTGTATGAATGAGC No data
Right 1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG No data
1181973441_1181973449 16 Left 1181973441 22:26711220-26711242 CCCAATGCAGGTGTATGAATGAG No data
Right 1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181973449 Original CRISPR CAATGAGCTCAGTCCTGCTG GGG Intergenic
No off target data available for this crispr