ID: 1181973940

View in Genome Browser
Species Human (GRCh38)
Location 22:26714803-26714825
Sequence ATGTACGACAGGAGGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181973940_1181973945 3 Left 1181973940 22:26714803-26714825 CCTTGGCCCCTCCTGTCGTACAT No data
Right 1181973945 22:26714829-26714851 CTCGTTTATCTCCTTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181973940 Original CRISPR ATGTACGACAGGAGGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr