ID: 1181974619

View in Genome Browser
Species Human (GRCh38)
Location 22:26720155-26720177
Sequence CAGTCCCAGCCCAGGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181974614_1181974619 17 Left 1181974614 22:26720115-26720137 CCAGTAAGGACCTCACTGTTCTC No data
Right 1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG No data
1181974615_1181974619 7 Left 1181974615 22:26720125-26720147 CCTCACTGTTCTCACTCACTAGT No data
Right 1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG No data
1181974613_1181974619 21 Left 1181974613 22:26720111-26720133 CCAGCCAGTAAGGACCTCACTGT No data
Right 1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181974619 Original CRISPR CAGTCCCAGCCCAGGGACTC TGG Intergenic
No off target data available for this crispr