ID: 1181974850

View in Genome Browser
Species Human (GRCh38)
Location 22:26721662-26721684
Sequence ACCAAAAACATCTCAAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 377}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181974850_1181974858 26 Left 1181974850 22:26721662-26721684 CCATGTCTTGAGATGTTTTTGGT 0: 1
1: 1
2: 4
3: 56
4: 377
Right 1181974858 22:26721711-26721733 CGTCTGCTGGGCAGAGACCAGGG 0: 1
1: 0
2: 6
3: 71
4: 482
1181974850_1181974855 14 Left 1181974850 22:26721662-26721684 CCATGTCTTGAGATGTTTTTGGT 0: 1
1: 1
2: 4
3: 56
4: 377
Right 1181974855 22:26721699-26721721 AGGTGCTACCAGCGTCTGCTGGG 0: 1
1: 0
2: 3
3: 14
4: 132
1181974850_1181974857 25 Left 1181974850 22:26721662-26721684 CCATGTCTTGAGATGTTTTTGGT 0: 1
1: 1
2: 4
3: 56
4: 377
Right 1181974857 22:26721710-26721732 GCGTCTGCTGGGCAGAGACCAGG 0: 1
1: 0
2: 5
3: 64
4: 501
1181974850_1181974854 13 Left 1181974850 22:26721662-26721684 CCATGTCTTGAGATGTTTTTGGT 0: 1
1: 1
2: 4
3: 56
4: 377
Right 1181974854 22:26721698-26721720 GAGGTGCTACCAGCGTCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 131
1181974850_1181974852 -6 Left 1181974850 22:26721662-26721684 CCATGTCTTGAGATGTTTTTGGT 0: 1
1: 1
2: 4
3: 56
4: 377
Right 1181974852 22:26721679-26721701 TTTGGTTGCCGTGATTGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1181974850_1181974851 -9 Left 1181974850 22:26721662-26721684 CCATGTCTTGAGATGTTTTTGGT 0: 1
1: 1
2: 4
3: 56
4: 377
Right 1181974851 22:26721676-26721698 GTTTTTGGTTGCCGTGATTGAGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181974850 Original CRISPR ACCAAAAACATCTCAAGACA TGG (reversed) Intergenic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
905501726 1:38445023-38445045 ACCTTAACCATTTCAAGACAGGG - Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907410181 1:54278400-54278422 ACCAGAGACATCTCATGCCACGG + Intronic
907741287 1:57168589-57168611 AACCAAAAAATCTCAAGACCAGG - Intronic
908292194 1:62679126-62679148 ACCATACACATATCAAGACAAGG + Intronic
909161519 1:72157116-72157138 AACAAAAACATAGCCAGACAAGG - Intronic
910500480 1:87884418-87884440 AGCAAAATCATATCAAGAGATGG - Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
911505985 1:98752118-98752140 ACCAAAAAAATCTCAAAACCTGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911793271 1:102045945-102045967 TCCATAAACATCCCAAGCCAAGG + Intergenic
911803679 1:102177546-102177568 ACCAGACAGATCTCAAGAGAGGG - Intergenic
912152043 1:106871590-106871612 AAAAAAAACAGCACAAGACAAGG - Intergenic
912657875 1:111503958-111503980 AGCAAAAAGATCTCATGATAAGG + Intronic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912746214 1:112247659-112247681 ACCCAAAACAGCTCAGGCCAAGG + Intergenic
912748113 1:112262802-112262824 ACCAAAAACACCTCGAAAGAGGG + Intergenic
913394836 1:118355091-118355113 ACAAACATCATCTCAAGCCAAGG - Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916281403 1:163055215-163055237 GCCAAAAACATCTGAAGAGGTGG - Intergenic
917230784 1:172835215-172835237 ACAGAAAACATCTAAACACATGG + Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
919532342 1:198738868-198738890 AACAACAACTTTTCAAGACATGG + Intronic
920626582 1:207607803-207607825 AACAAATACAACTGAAGACATGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921210046 1:212887408-212887430 ACCACAAACATCTTAAGAACAGG - Intronic
921511310 1:216034082-216034104 AGGAAAAATATCTGAAGACAAGG + Intronic
923170602 1:231413366-231413388 ACCAAACACATTTCAAGTTAGGG + Intronic
923294808 1:232583570-232583592 GCCATAAACATTTCAAGACTGGG + Intergenic
924591453 1:245408248-245408270 ATCATAAACATCACAAAACACGG + Intronic
924690112 1:246340003-246340025 CACAAAAACAGATCAAGACAAGG + Intronic
924782319 1:247162676-247162698 ACCAAAAACAAAAAAAGACACGG + Intronic
1062884812 10:1008464-1008486 AACATAACCAACTCAAGACACGG - Intronic
1066626448 10:37411598-37411620 ACCAAAGACATTACAAGAAAAGG + Intergenic
1067818054 10:49498270-49498292 ACCAAAATCATCTCAAATTAGGG + Intronic
1067978109 10:51049131-51049153 CCCAGAAACATCACAAGTCATGG + Intronic
1068059831 10:52052919-52052941 ACCAAAACCTTTTTAAGACAGGG - Intronic
1068490445 10:57717150-57717172 ATCAAACACATCTTAAGACCTGG + Intergenic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1075120814 10:119663270-119663292 ACCAAAAACAAATGAAGAGAAGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076232531 10:128833684-128833706 AGCAAAAACATCTCTAGGAAAGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078708723 11:13769747-13769769 ACCAGAAACATCATAAGACTAGG + Intergenic
1078974967 11:16463234-16463256 ACAAAAAATATATAAAGACAAGG - Intronic
1079557515 11:21778418-21778440 AGCAAAAACATCATAAGAGATGG + Intergenic
1079919497 11:26414813-26414835 ACAAAAAAAATCTCAAATCAAGG - Intronic
1080721822 11:34856604-34856626 CCCAAGAACATTTCAAGAGATGG + Intronic
1081141860 11:39511307-39511329 AACCAAAACATATCAAAACATGG - Intergenic
1081877800 11:46421947-46421969 CCTAAAAACATCTCAAGTAAAGG + Intronic
1082131076 11:48490351-48490373 ACCTGAAACATCTTAAGAAATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083134661 11:60661060-60661082 ACCAAATAAAACTTAAGACAAGG + Intergenic
1083391428 11:62353720-62353742 ACCAAGAACATCTCAACCTAAGG - Intronic
1083709119 11:64537053-64537075 TCCAAGAAGATCTCAAGAAATGG + Intergenic
1083998065 11:66282006-66282028 TTCCAAAACATCCCAAGACATGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084590842 11:70089316-70089338 ACCAAAAGCATTTAAGGACATGG - Intronic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085827450 11:79863412-79863434 ACCAGAAAAATCCCAGGACAAGG + Intergenic
1085933603 11:81117245-81117267 ACCAAATAGATCTCAATACAAGG - Intergenic
1087730365 11:101771918-101771940 ACCAAAAACATGTGGGGACATGG + Intronic
1088398516 11:109396251-109396273 GCCAAAATAATCTCAAGAAAAGG + Intergenic
1088789730 11:113213953-113213975 AGCAAAAACATATGAAGAGATGG - Intronic
1088983508 11:114885649-114885671 AAAAAAAAAACCTCAAGACATGG + Intergenic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093006403 12:14056233-14056255 ACCAAAAACATTCCAAGAAAGGG + Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095657562 12:44687516-44687538 ACCAAAGACATCTGAAAAAAAGG - Intronic
1097289663 12:57904115-57904137 ATAAAAAACACCTCATGACATGG + Intergenic
1097349546 12:58533507-58533529 ACCAAAAATTTCACAAGTCAGGG - Intergenic
1097354932 12:58590566-58590588 ACTAAAACCAGCTCCAGACAAGG - Intronic
1098400481 12:70069939-70069961 ACCAAAAAAATCTCACCAGATGG - Intergenic
1099316363 12:81087272-81087294 ACCATAAACACCTTAAGAGAAGG - Intronic
1099517840 12:83620507-83620529 ACCAAAACAATCCCAAAACATGG - Intergenic
1101246637 12:102890081-102890103 ACCCAAAACAGCTTAAGAGAAGG - Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101452399 12:104791274-104791296 TCCAAAAACATTTAATGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1103913458 12:124364145-124364167 CCCAAAGACATCTCCAGGCAAGG + Intronic
1104206016 12:126639283-126639305 AACAGACACTTCTCAAGACAAGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1104742181 12:131185757-131185779 AACAAAAACAACTCAAAATATGG + Intergenic
1106163752 13:27223725-27223747 CTCAAAAACATTTCAAGAAATGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107630763 13:42340754-42340776 CCCAAAAACATCACAAGAAAGGG - Intergenic
1107871143 13:44747853-44747875 AGCAAATATATCTCAAGAAAAGG + Intergenic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108837471 13:54569890-54569912 ACCAAAAACAGATGAAAACATGG + Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109403352 13:61863865-61863887 ACCAACATGATCACAAGACATGG + Intergenic
1109561524 13:64055804-64055826 ACCACAAACCTCAAAAGACAGGG + Intergenic
1110446091 13:75582895-75582917 AGCAATAACATTTCAAGAGATGG - Intronic
1111527876 13:89495806-89495828 TCCAAAATCATCTCAAGAAAAGG + Intergenic
1112047147 13:95609538-95609560 ACAAAAAACATCACAAGCTATGG + Intronic
1113282928 13:108809919-108809941 ACCATAAACATCTATAGAAAGGG + Intronic
1113876046 13:113595339-113595361 ATAAAAGACATCTCAGGACACGG + Intronic
1114295568 14:21326069-21326091 ATCAAAAACATGTATAGACAAGG - Exonic
1115673085 14:35638252-35638274 AACAACAACTTTTCAAGACATGG + Intronic
1116302775 14:43206942-43206964 CCTAAGAACAACTCAAGACAAGG - Intergenic
1118118823 14:62812631-62812653 ACCAAAATCCTCTAAAGAAATGG + Intronic
1120465714 14:84854693-84854715 CCAAAAAACATTTCAAAACATGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122538316 14:102481780-102481802 ACCAGAAACACCTGAAGTCAGGG - Intronic
1123918723 15:25055829-25055851 AGCCAAAGGATCTCAAGACACGG - Intergenic
1123920955 15:25069417-25069439 AGCCAAACAATCTCAAGACACGG - Intergenic
1124215192 15:27801165-27801187 ACCAAAGACATTACAAGAAAAGG + Intronic
1125982716 15:44017553-44017575 CCCAAAATCAGCTCAATACATGG - Intronic
1126211102 15:46101401-46101423 ACCAGAAAATTATCAAGACATGG + Intergenic
1127105109 15:55605440-55605462 ACCAAAAAAAGCCCAAGACCAGG + Intergenic
1127209181 15:56754805-56754827 ACCTAAAACATCTCATCAGATGG - Intronic
1127241520 15:57120703-57120725 ACCAAAAACATTTTAGGAGAAGG - Intronic
1127515972 15:59693568-59693590 ACCAAAAACTACACAAGAAAAGG - Intergenic
1128442578 15:67726026-67726048 AACAAAAACATCACAAGATGGGG - Intronic
1129132955 15:73517074-73517096 ACCTGAAACCTCTTAAGACAGGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130411438 15:83652163-83652185 ACCAAAAAAATGTGAAAACATGG - Intergenic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134839422 16:17389876-17389898 ACTAAAAATACCTCAAGACCTGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135481633 16:22825617-22825639 ACCAAAAACATCTCTATCCAAGG - Intronic
1138996477 16:62459294-62459316 AACAAAAACTTCTCAAAAGAAGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1142165353 16:88583993-88584015 TGCAAAGACAACTCAAGACAGGG - Intronic
1143811948 17:9478968-9478990 AACAAATACATCTCAAAATAAGG - Intronic
1144305130 17:13962891-13962913 AAGATAAACATCTCAGGACATGG - Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145274093 17:21419875-21419897 AGAAAACACATCTCAACACAGGG - Intergenic
1145780913 17:27562513-27562535 ACCAAAGCCATCTCATGGCAGGG - Intronic
1146046071 17:29508851-29508873 ACCAAAAACATTAGAAGAAAAGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148292303 17:46464419-46464441 ATCCAAAACACCTCAAGACCAGG - Intergenic
1148314488 17:46682111-46682133 ATCCAAAACACCTCAAGACCAGG - Intronic
1149750912 17:59144416-59144438 ACCTAAAACAACTAAAAACAGGG + Intronic
1150561691 17:66300874-66300896 ACTAGAAGCATCTCAAGCCATGG - Intergenic
1150603610 17:66672412-66672434 ACCAAAACCATATCAAGAAGTGG - Intronic
1150892997 17:69176410-69176432 ACAAAAAAAATCTAAAGAAAAGG + Intronic
1150918104 17:69456791-69456813 ATGAAAAACATCTCTAGATAAGG - Intronic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1153990911 18:10399475-10399497 ACCAAAAACATCATTATACAGGG - Intergenic
1155378088 18:25184002-25184024 ACCAAAAATACATCAAAACAAGG + Intronic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156178899 18:34580555-34580577 CCCAAATACATCTAAAGCCAAGG - Intronic
1157070230 18:44398744-44398766 ACCATAATCATCCCATGACAAGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157793736 18:50556995-50557017 AGCACAAACATATTAAGACAAGG + Intergenic
1158932880 18:62338325-62338347 ACCAAAAAGAACTGAAAACAGGG + Intronic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1159888043 18:73928070-73928092 AACCAAAACAGCTCAAGGCATGG + Intergenic
1161412732 19:4125531-4125553 ACCCAAAAGAACTCAAGGCAAGG - Intergenic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1166144899 19:40827164-40827186 CCCGGAAACATCCCAAGACACGG + Intronic
1166182841 19:41121036-41121058 CCCGGAAACATCCCAAGACACGG - Intronic
1167827919 19:51990619-51990641 ACAGAAAACTTCTCAAGACCAGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168423865 19:56223195-56223217 CACAAAAGCATCTCCAGACATGG + Intronic
1168426834 19:56245839-56245861 CACAAACACATCTCCAGACATGG - Intronic
925742093 2:7014957-7014979 ACCAAATAGATCACTAGACAAGG - Intronic
926528204 2:14009015-14009037 AACATAACCTTCTCAAGACAGGG - Intergenic
926800683 2:16657456-16657478 ACAAAAAACATCAAAAAACATGG - Intronic
927032215 2:19132663-19132685 AGCAAAAGCATCACAAGCCATGG - Intergenic
927694880 2:25232865-25232887 ACCAAAAACATCACATTCCAGGG + Exonic
927841063 2:26444532-26444554 TCCCAACACATCTCAAGAAAAGG - Intronic
929245567 2:39698615-39698637 ACCAAAGACACCACAAGAAAAGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930364307 2:50419930-50419952 ACCAAATACATCTGAATGCATGG + Intronic
930450461 2:51530198-51530220 CACAAAAACATCACAAGAAAAGG - Intergenic
930468612 2:51785095-51785117 ACAAACTACATCTCAAGACAGGG - Intergenic
930909168 2:56610183-56610205 AACAAAAAAATTGCAAGACATGG - Intergenic
931561808 2:63569946-63569968 ACAAAAGACAGCTCAAGAAAAGG + Intronic
933621047 2:84541764-84541786 ACAAAAAAAATGTGAAGACAAGG - Intronic
934941535 2:98506599-98506621 ACCAAGAACTTCTCAGGCCAAGG - Intronic
935751332 2:106236682-106236704 AACTACAACATTTCAAGACATGG + Intergenic
935817718 2:106862802-106862824 AGAAAAAACATTTCTAGACAGGG + Intronic
936344463 2:111664687-111664709 ACCAGAACCATCTCAAACCAGGG + Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938214446 2:129498802-129498824 AACAAAGACATCACAAGAAATGG + Intergenic
938600652 2:132835423-132835445 ACAAAAATCATCTCAGGAGAAGG - Intronic
939113005 2:138030353-138030375 ACCTAAAACAACACAACACATGG + Intergenic
939122014 2:138128742-138128764 AACAAAAACATGTAAAGATAAGG + Intergenic
939718057 2:145610302-145610324 AGCAAAAACATCTCAATTGAGGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940630980 2:156238208-156238230 ACCAAAAAAATCTCTGGACCTGG + Intergenic
940787688 2:157999891-157999913 ACTAAAAACATCAAAAGAGATGG + Intronic
940862898 2:158788492-158788514 ACCTGAAACATCTCAACCCATGG + Intergenic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
942964870 2:181879799-181879821 ACCAAGAACATATAAAAACATGG + Intergenic
944873146 2:203934209-203934231 ATCAAAACCATCTTAAGTCATGG + Intergenic
945034104 2:205689330-205689352 ACCAAACACATTTACAGACAAGG - Intronic
946180078 2:217943628-217943650 CACAGAAACATCTGAAGACAGGG + Intronic
946780333 2:223188146-223188168 CCCAATAAGATCTCAAGACCAGG - Intronic
947287481 2:228532621-228532643 ACCAAAAAAATATCTAGAGAAGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948553327 2:238790732-238790754 GCCAAACACATCTACAGACATGG + Intergenic
948779268 2:240307993-240308015 ACCAAAACCACCTGAATACAAGG - Intergenic
1168917006 20:1498015-1498037 TACAAAAACTTTTCAAGACATGG - Intergenic
1169401037 20:5280636-5280658 AGCAAAAACATCAAAAGACATGG + Intergenic
1169777181 20:9268322-9268344 ACCAAACACAGCAGAAGACATGG - Intronic
1169798065 20:9486322-9486344 ACCAAAAAAATGAAAAGACAGGG - Intergenic
1169836879 20:9890288-9890310 AATAAAAACATCTCCAGACTGGG + Intergenic
1170346563 20:15393356-15393378 AACAAAAACATCTGGAGAAAGGG - Intronic
1171952288 20:31431216-31431238 ACCATAAACATCTAGAAACAGGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174034210 20:47657396-47657418 ACCAAAAAACTCCCAAGAAATGG + Exonic
1174445188 20:50586302-50586324 AACACAGACATCTCAGGACATGG + Exonic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175578322 20:60079309-60079331 ACCAGAAGCATCTCTTGACAAGG + Intergenic
1175837608 20:62006237-62006259 ACCAGTAACATCCCCAGACAAGG + Intronic
1176987257 21:15451908-15451930 AGCAAAATCAGCACAAGACAAGG - Intergenic
1178286574 21:31330383-31330405 ACCAAAAACAACTCTGCACACGG - Intronic
1178335578 21:31739804-31739826 ACCAAAACCATTACAAGAAAAGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179334348 21:40436394-40436416 ACCTAGAACTTCTCAAAACAAGG + Intronic
1179778903 21:43687088-43687110 ACCAAAAACAGCACAACACTTGG - Intronic
1180182097 21:46122628-46122650 GCCAGGACCATCTCAAGACAGGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183222253 22:36522990-36523012 ACGGAAAACAGATCAAGACAGGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183819698 22:40335958-40335980 AACAAAAACATGACAAGACAAGG - Intergenic
1183851783 22:40595620-40595642 AACAAAAACAGTTCAAGAAATGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184633032 22:45800955-45800977 GCCACAAACAAATCAAGACATGG - Intronic
1184751920 22:46491168-46491190 AACCGAAACATCTCCAGACATGG + Intronic
949408799 3:3741992-3742014 TCCAGAAGCATCGCAAGACAAGG + Intronic
949427274 3:3931576-3931598 ACCAAAAAAATTACAAGAAAGGG + Intronic
949809043 3:7986087-7986109 AGGAATAAAATCTCAAGACAGGG + Intergenic
949958669 3:9292534-9292556 ACAAAAAACATTTCAAAGCATGG - Intronic
952018783 3:28991775-28991797 ACAAAATACACCTCAAGACGTGG - Intergenic
953121042 3:40042473-40042495 ACCATAAACATAAAAAGACAAGG + Intronic
953204830 3:40816483-40816505 AACAAAAACCTCTAAATACATGG + Intergenic
953617513 3:44504566-44504588 ACCAAAATCATATTAAAACAAGG + Intronic
953762212 3:45697751-45697773 ACCAAATATCTGTCAAGACAAGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
959102848 3:102033093-102033115 ACCAAGAACATTTAAGGACATGG - Intergenic
959632418 3:108522222-108522244 AACAAAAAAATCCCAAGAAAGGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
963209621 3:142674655-142674677 TCCAACAACTTCTCAACACATGG - Intronic
963311580 3:143715747-143715769 ACAAGAAACATCACAAGCCAAGG + Intronic
963413451 3:144962106-144962128 ACAAAAAACAGCCCAAGACTGGG - Intergenic
963798093 3:149651327-149651349 ACCAAAAAAATAGGAAGACACGG + Intronic
963843157 3:150128686-150128708 ACCAATCACATCCCAATACAGGG + Intergenic
964194331 3:154045238-154045260 AGCAGAAACATATAAAGACAGGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964769955 3:160213860-160213882 AACAAAAACTTATCTAGACATGG - Intergenic
964878571 3:161397947-161397969 ACCAAAAAAAGCTCAGGACCAGG + Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
964942710 3:162178928-162178950 ACCAAAAACTTCTCAAAATATGG - Intergenic
965208008 3:165746845-165746867 ACAAAGAACGTTTCAAGACATGG + Intergenic
966528462 3:180945707-180945729 ACCACAAACATCTTAAAAGATGG + Intronic
966957965 3:184903618-184903640 AAAAAAAAATTCTCAAGACAGGG + Intronic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967677747 3:192319627-192319649 TACAAAAACCTTTCAAGACATGG + Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970708525 4:18834194-18834216 GCCAAATAGATCTAAAGACAAGG + Intergenic
971148126 4:24001951-24001973 ATCAAAAACATACCAAGAAATGG + Intergenic
971515022 4:27474814-27474836 ACCACAACCTTCTCAAGCCAAGG - Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
971671025 4:29558293-29558315 CCCAATAAGATCTCAAGATATGG + Intergenic
972630315 4:40836502-40836524 ACAAAAAACATGTCAAACCAAGG + Intronic
975200075 4:71576810-71576832 GACAAAAACATCACAAGAAAAGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976395822 4:84554498-84554520 TTGAAAAACACCTCAAGACAGGG + Intergenic
976752697 4:88466060-88466082 ACCAAAAACAACTCTTGACTTGG - Intronic
977377762 4:96228864-96228886 ATCAAAAACACCTCTAGAAATGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978988955 4:115053748-115053770 ACCACATACATCCCAAGTCATGG - Intronic
979217070 4:118178668-118178690 ACCTAAAACAACTGAAAACAGGG - Intronic
980820954 4:138016599-138016621 AACATAAACATTTCAAAACATGG + Intergenic
983000014 4:162402469-162402491 ATCAAAAACATCAAAAGAGAAGG - Intergenic
983131999 4:164031954-164031976 ACCAAAAACAACCCAAGACCAGG - Intronic
983528438 4:168784577-168784599 ACCACAAACATGTTGAGACAAGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984127427 4:175829297-175829319 ACCATAATCATATCAAGACAGGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984702152 4:182825401-182825423 CCCAAAAACATCCCAGGAGAAGG - Intergenic
985172129 4:187162706-187162728 ACCAATAACATTTCCAGAGAAGG + Intergenic
986358863 5:6955646-6955668 ACCAAAAAAAGCCCAAGACCAGG + Intergenic
986755629 5:10833299-10833321 ACTAAAAACAGCTAAAAACATGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988936263 5:36086009-36086031 ACCAAAATCATATCAAGTCATGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989250018 5:39302307-39302329 ACCATAAATATATCAACACATGG - Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990111201 5:52327538-52327560 AACAAAATCCTCTCAATACACGG + Intergenic
990445902 5:55894111-55894133 AAAAAAAAAATCTAAAGACAAGG - Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992288913 5:75264512-75264534 GCACAAAACAACTCAAGACAGGG - Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993224000 5:85141658-85141680 ACCAAAATAATGTCAAGACTTGG - Intergenic
997383585 5:133455116-133455138 ACCACAAACCTCCCAAGGCAGGG - Intronic
997501953 5:134382295-134382317 ACAAAAAAAATATCAAGGCATGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
998783134 5:145680673-145680695 ACCAAAAACATCAGAAGCCAAGG - Intronic
999253809 5:150198354-150198376 GACCAAAACATTTCAAGACACGG - Intronic
999632309 5:153583698-153583720 ACCCAAAACATGACATGACATGG + Intronic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001228388 5:169964697-169964719 ACCAATAAGATTTGAAGACAGGG - Intronic
1002950609 6:1806976-1806998 ACCAGAAAAATCTCAATACGGGG + Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005121713 6:22397206-22397228 AACAAAAACATTTGAAAACATGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007118054 6:39357809-39357831 GCCAAAAACAAATCTAGACATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009982203 6:70740497-70740519 AACAAGAACATCTCAACAAATGG - Intronic
1010141392 6:72619072-72619094 AGCAAACACATCTCAAAAGATGG + Intergenic
1011094957 6:83650723-83650745 ACCAAAGACATTACAAGAAAAGG - Intronic
1011411563 6:87071703-87071725 TCAAAAAACATCCCAAGACAGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012901353 6:105010795-105010817 CTCAAACCCATCTCAAGACATGG + Intronic
1013161187 6:107546888-107546910 AACATAAACAACTGAAGACAAGG + Intronic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1014560320 6:122881927-122881949 ACCAAAAAAAGCTCAGGACCAGG - Intergenic
1017866200 6:158445515-158445537 ACCAAAAGCATCTCAAGGGCAGG - Intronic
1019957846 7:4430745-4430767 ACCAAAAACAAGTCAACAAAAGG + Intergenic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022205630 7:28160633-28160655 ACCAAAACCATCTCATCAGAAGG + Intronic
1022788438 7:33662637-33662659 ACTAAAAACACATAAAGACAAGG + Intergenic
1023878035 7:44301281-44301303 ACAAAAAACATCACAGGGCATGG - Intronic
1026732197 7:72921731-72921753 ACCATAAACAACTGTAGACATGG - Intronic
1027111770 7:75445616-75445638 ACCATAAACAACTGTAGACATGG + Intronic
1027284000 7:76630147-76630169 ACCATAAACAACTGTAGACATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027894109 7:84018642-84018664 ACCAGAAACATCTCAGGTGAAGG + Intronic
1028981185 7:96969739-96969761 ACCAAAAACATCAAAAGTGATGG + Intergenic
1029260773 7:99301425-99301447 ACCATAAACTTCCCAAGACCAGG + Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030730302 7:112980045-112980067 AACAAAAACATCTAAATACCAGG - Intergenic
1030772953 7:113497582-113497604 AACAAAAACATCTAAATACCAGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032712656 7:134474289-134474311 ACAAAAAACCTCTCAAAAAATGG - Intergenic
1033621721 7:143067930-143067952 ATCTAAAACATCTCAAGTCTTGG + Intergenic
1036270185 8:7296982-7297004 ATCAAACACATCCAAAGACAAGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037231588 8:16664980-16665002 CTCAAAAACCTCTCAAAACATGG - Intergenic
1037601719 8:20401875-20401897 ACAAAAATCAACTCAAGATACGG - Intergenic
1038131314 8:24734620-24734642 ACCAATAAAATTTCAAGACAAGG + Intergenic
1038507582 8:28098457-28098479 AAGAAAAACTTCTAAAGACACGG - Intronic
1039020828 8:33204353-33204375 ACCAAACACATCACAAAATATGG + Intergenic
1040849225 8:51881379-51881401 ACCAACAACCCCTCAAGACTAGG + Intronic
1041598103 8:59681314-59681336 ACCAAAGACATTGCAAGAAAAGG + Intergenic
1042029126 8:64455357-64455379 AAGAAAAAAATCTCAAGAGAAGG + Intergenic
1042361865 8:67892605-67892627 ATCTAAAACACCTCAATACATGG + Intergenic
1043234736 8:77848954-77848976 ACCAAAACTAACTCAAAACAGGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043820591 8:84858810-84858832 TACAAAAACATAACAAGACAAGG - Intronic
1045120649 8:99030044-99030066 GCTGAAAACATCTCAAGTCACGG - Intronic
1045328116 8:101132274-101132296 AGCTAGAACATCTCTAGACAAGG - Intergenic
1045807891 8:106186746-106186768 ATGAAAAACATCTCCAGGCAAGG - Intergenic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046246223 8:111566488-111566510 ACCTAAAACATTTCAACATATGG - Intergenic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048561901 8:135548186-135548208 ACCAAGCACTTCTCTAGACATGG + Intronic
1048773847 8:137923657-137923679 ACTAAAATCATCTCAAGGTAAGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051489914 9:17650655-17650677 GCCATAAAAACCTCAAGACAAGG - Intronic
1051514816 9:17917648-17917670 ACCAAAGATATTTCAAGAAAAGG - Intergenic
1052059087 9:23938782-23938804 AGAAGAAACATCTCAAGAGAAGG - Intergenic
1052198669 9:25749878-25749900 ACAAAAAACATCCTAACACATGG + Intergenic
1052688914 9:31790256-31790278 AACAAAAACACATAAAGACAGGG + Intergenic
1054930973 9:70634978-70635000 ACCAAAAGCATCTAAAAGCACGG + Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1058664658 9:107300251-107300273 ACTAAAAGAATATCAAGACATGG - Intronic
1059208494 9:112487538-112487560 TCCATAAGCATCTCAAGACTTGG - Intronic
1059852706 9:118362332-118362354 AACAAAAACAACTGAAGACTGGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188876847 X:35441023-35441045 ACCAAAAACATATAGAGAGAAGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190398449 X:50008087-50008109 ACCAGAATCATCTGAAGACCTGG - Intronic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1191589331 X:62863724-62863746 ACCAAAAATATTTAAAGAGAGGG - Intergenic
1193572959 X:83166514-83166536 ACAAAGAACTTCTCAAGACTGGG - Intergenic
1193816050 X:86106440-86106462 ATAAAAAACTTCTCAAGACTGGG + Intergenic
1194436866 X:93877209-93877231 ACCAAAAAAAGCTCAGGACCAGG + Intergenic
1194506128 X:94735808-94735830 ACCAAAAAAAGCCCAGGACATGG - Intergenic
1195051516 X:101101185-101101207 TCGAAGAACATCTCAAAACATGG + Exonic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195804577 X:108749058-108749080 ACCAAATACATTTCAAGATTAGG - Intergenic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196219416 X:113094833-113094855 ACAAAAAACATAGCCAGACATGG + Intergenic
1197020618 X:121683498-121683520 ACCAAAAACATTGCAACTCAGGG + Intergenic
1197160328 X:123315799-123315821 ACCAAAGACATTGCAAGAAATGG + Intronic
1197188776 X:123621301-123621323 ATCAAAATCAACTCAAGAAAGGG - Exonic
1197382570 X:125763558-125763580 ACCATAAAAATTTTAAGACATGG - Intergenic
1197597961 X:128489984-128490006 TTCAAAAACATCTCAACAGATGG + Intergenic
1198401353 X:136271256-136271278 ACCAAAAAAATGTCAAAAGAGGG - Intergenic
1198580060 X:138053645-138053667 ACAAAAATCAACTCAAGATAAGG + Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic