ID: 1181976432

View in Genome Browser
Species Human (GRCh38)
Location 22:26734001-26734023
Sequence CATGATTAAGTTAAGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181976432_1181976435 5 Left 1181976432 22:26734001-26734023 CCTAGATCCTTAACTTAATCATG No data
Right 1181976435 22:26734029-26734051 AAAGTCCCTTTCACCATGTGAGG No data
1181976432_1181976439 28 Left 1181976432 22:26734001-26734023 CCTAGATCCTTAACTTAATCATG No data
Right 1181976439 22:26734052-26734074 TAAAGTATTCTCTCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181976432 Original CRISPR CATGATTAAGTTAAGGATCT AGG (reversed) Intergenic
No off target data available for this crispr