ID: 1181978862

View in Genome Browser
Species Human (GRCh38)
Location 22:26752202-26752224
Sequence GTGTGCTTGAGGAAGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181978858_1181978862 8 Left 1181978858 22:26752171-26752193 CCGATGCTCAGAGAGGGGTGGGG No data
Right 1181978862 22:26752202-26752224 GTGTGCTTGAGGAAGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181978862 Original CRISPR GTGTGCTTGAGGAAGAGACC TGG Intergenic
No off target data available for this crispr