ID: 1181979445

View in Genome Browser
Species Human (GRCh38)
Location 22:26755669-26755691
Sequence CTACCTGTCTTCTACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181979445_1181979453 30 Left 1181979445 22:26755669-26755691 CCCTGCAGGTAGAAGACAGGTAG No data
Right 1181979453 22:26755722-26755744 GCTCCAAGGAAATGTGTGTTGGG No data
1181979445_1181979452 29 Left 1181979445 22:26755669-26755691 CCCTGCAGGTAGAAGACAGGTAG No data
Right 1181979452 22:26755721-26755743 AGCTCCAAGGAAATGTGTGTTGG No data
1181979445_1181979451 16 Left 1181979445 22:26755669-26755691 CCCTGCAGGTAGAAGACAGGTAG No data
Right 1181979451 22:26755708-26755730 TGAAATAGATGAGAGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181979445 Original CRISPR CTACCTGTCTTCTACCTGCA GGG (reversed) Intergenic
No off target data available for this crispr