ID: 1181981354

View in Genome Browser
Species Human (GRCh38)
Location 22:26769088-26769110
Sequence AGGGGCTGTCTGCCCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181981347_1181981354 0 Left 1181981347 22:26769065-26769087 CCTAGAATTTAGTTCTCTGCAGG No data
Right 1181981354 22:26769088-26769110 AGGGGCTGTCTGCCCAGGCTGGG No data
1181981346_1181981354 11 Left 1181981346 22:26769054-26769076 CCTCACTGTGGCCTAGAATTTAG No data
Right 1181981354 22:26769088-26769110 AGGGGCTGTCTGCCCAGGCTGGG No data
1181981345_1181981354 19 Left 1181981345 22:26769046-26769068 CCAATTGTCCTCACTGTGGCCTA No data
Right 1181981354 22:26769088-26769110 AGGGGCTGTCTGCCCAGGCTGGG No data
1181981344_1181981354 20 Left 1181981344 22:26769045-26769067 CCCAATTGTCCTCACTGTGGCCT No data
Right 1181981354 22:26769088-26769110 AGGGGCTGTCTGCCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181981354 Original CRISPR AGGGGCTGTCTGCCCAGGCT GGG Intergenic