ID: 1181982731

View in Genome Browser
Species Human (GRCh38)
Location 22:26777314-26777336
Sequence GCTAAACCCATATTCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982731_1181982735 22 Left 1181982731 22:26777314-26777336 CCCACGTGGAATATGGGTTTAGC No data
Right 1181982735 22:26777359-26777381 CTGTTTCTTCAGTTATAAAATGG No data
1181982731_1181982736 23 Left 1181982731 22:26777314-26777336 CCCACGTGGAATATGGGTTTAGC No data
Right 1181982736 22:26777360-26777382 TGTTTCTTCAGTTATAAAATGGG No data
1181982731_1181982737 24 Left 1181982731 22:26777314-26777336 CCCACGTGGAATATGGGTTTAGC No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982731 Original CRISPR GCTAAACCCATATTCCACGT GGG (reversed) Intergenic
No off target data available for this crispr