ID: 1181982732

View in Genome Browser
Species Human (GRCh38)
Location 22:26777315-26777337
Sequence TGCTAAACCCATATTCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982732_1181982737 23 Left 1181982732 22:26777315-26777337 CCACGTGGAATATGGGTTTAGCA No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data
1181982732_1181982736 22 Left 1181982732 22:26777315-26777337 CCACGTGGAATATGGGTTTAGCA No data
Right 1181982736 22:26777360-26777382 TGTTTCTTCAGTTATAAAATGGG No data
1181982732_1181982735 21 Left 1181982732 22:26777315-26777337 CCACGTGGAATATGGGTTTAGCA No data
Right 1181982735 22:26777359-26777381 CTGTTTCTTCAGTTATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982732 Original CRISPR TGCTAAACCCATATTCCACG TGG (reversed) Intergenic
No off target data available for this crispr