ID: 1181982733

View in Genome Browser
Species Human (GRCh38)
Location 22:26777347-26777369
Sequence TGAAGAAACAGAGTCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982733_1181982736 -10 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982736 22:26777360-26777382 TGTTTCTTCAGTTATAAAATGGG No data
1181982733_1181982738 10 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982738 22:26777380-26777402 GGGGATGTTTTAGATACCCCAGG No data
1181982733_1181982737 -9 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data
1181982733_1181982739 15 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982739 22:26777385-26777407 TGTTTTAGATACCCCAGGACAGG No data
1181982733_1181982741 25 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982741 22:26777395-26777417 ACCCCAGGACAGGGTCACAGTGG No data
1181982733_1181982740 16 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982740 22:26777386-26777408 GTTTTAGATACCCCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982733 Original CRISPR TGAAGAAACAGAGTCAGAGA GGG (reversed) Intergenic
No off target data available for this crispr