ID: 1181982734

View in Genome Browser
Species Human (GRCh38)
Location 22:26777348-26777370
Sequence CTGAAGAAACAGAGTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982734_1181982739 14 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982739 22:26777385-26777407 TGTTTTAGATACCCCAGGACAGG No data
1181982734_1181982741 24 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982741 22:26777395-26777417 ACCCCAGGACAGGGTCACAGTGG No data
1181982734_1181982738 9 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982738 22:26777380-26777402 GGGGATGTTTTAGATACCCCAGG No data
1181982734_1181982740 15 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982740 22:26777386-26777408 GTTTTAGATACCCCAGGACAGGG No data
1181982734_1181982737 -10 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982734 Original CRISPR CTGAAGAAACAGAGTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr