ID: 1181982737

View in Genome Browser
Species Human (GRCh38)
Location 22:26777361-26777383
Sequence GTTTCTTCAGTTATAAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982732_1181982737 23 Left 1181982732 22:26777315-26777337 CCACGTGGAATATGGGTTTAGCA No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data
1181982733_1181982737 -9 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data
1181982730_1181982737 27 Left 1181982730 22:26777311-26777333 CCACCCACGTGGAATATGGGTTT No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data
1181982734_1181982737 -10 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data
1181982731_1181982737 24 Left 1181982731 22:26777314-26777336 CCCACGTGGAATATGGGTTTAGC No data
Right 1181982737 22:26777361-26777383 GTTTCTTCAGTTATAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982737 Original CRISPR GTTTCTTCAGTTATAAAATG GGG Intergenic
No off target data available for this crispr