ID: 1181982738

View in Genome Browser
Species Human (GRCh38)
Location 22:26777380-26777402
Sequence GGGGATGTTTTAGATACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982734_1181982738 9 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982738 22:26777380-26777402 GGGGATGTTTTAGATACCCCAGG No data
1181982733_1181982738 10 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982738 22:26777380-26777402 GGGGATGTTTTAGATACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982738 Original CRISPR GGGGATGTTTTAGATACCCC AGG Intergenic
No off target data available for this crispr