ID: 1181982740

View in Genome Browser
Species Human (GRCh38)
Location 22:26777386-26777408
Sequence GTTTTAGATACCCCAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181982734_1181982740 15 Left 1181982734 22:26777348-26777370 CCTCTCTGACTCTGTTTCTTCAG No data
Right 1181982740 22:26777386-26777408 GTTTTAGATACCCCAGGACAGGG No data
1181982733_1181982740 16 Left 1181982733 22:26777347-26777369 CCCTCTCTGACTCTGTTTCTTCA No data
Right 1181982740 22:26777386-26777408 GTTTTAGATACCCCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181982740 Original CRISPR GTTTTAGATACCCCAGGACA GGG Intergenic
No off target data available for this crispr