ID: 1181983113

View in Genome Browser
Species Human (GRCh38)
Location 22:26780458-26780480
Sequence TGAAGACTTCCCAAGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181983113_1181983118 -3 Left 1181983113 22:26780458-26780480 CCAGAGACCTTGGGAAGTCTTCA No data
Right 1181983118 22:26780478-26780500 TCAGCCAAGGGCAGACCAGGAGG No data
1181983113_1181983117 -6 Left 1181983113 22:26780458-26780480 CCAGAGACCTTGGGAAGTCTTCA No data
Right 1181983117 22:26780475-26780497 TCTTCAGCCAAGGGCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181983113 Original CRISPR TGAAGACTTCCCAAGGTCTC TGG (reversed) Intergenic