ID: 1181983114

View in Genome Browser
Species Human (GRCh38)
Location 22:26780465-26780487
Sequence CCTTGGCTGAAGACTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181983114_1181983118 -10 Left 1181983114 22:26780465-26780487 CCTTGGGAAGTCTTCAGCCAAGG No data
Right 1181983118 22:26780478-26780500 TCAGCCAAGGGCAGACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181983114 Original CRISPR CCTTGGCTGAAGACTTCCCA AGG (reversed) Intergenic