ID: 1181987064

View in Genome Browser
Species Human (GRCh38)
Location 22:26807136-26807158
Sequence CTGTGCTTCGGGAAGGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181987064_1181987068 20 Left 1181987064 22:26807136-26807158 CCTGGCGCCTTCCCGAAGCACAG No data
Right 1181987068 22:26807179-26807201 ACAACCTATGTGCCCTGTGCTGG No data
1181987064_1181987069 21 Left 1181987064 22:26807136-26807158 CCTGGCGCCTTCCCGAAGCACAG No data
Right 1181987069 22:26807180-26807202 CAACCTATGTGCCCTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181987064 Original CRISPR CTGTGCTTCGGGAAGGCGCC AGG (reversed) Intergenic
No off target data available for this crispr