ID: 1181987251

View in Genome Browser
Species Human (GRCh38)
Location 22:26808786-26808808
Sequence TGGGAGACAGGACAGCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181987251_1181987260 30 Left 1181987251 22:26808786-26808808 CCAACTGGCTGTCCTGTCTCCCA No data
Right 1181987260 22:26808839-26808861 CTTCCATGTCCCATTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181987251 Original CRISPR TGGGAGACAGGACAGCCAGT TGG (reversed) Intergenic
No off target data available for this crispr