ID: 1181991264

View in Genome Browser
Species Human (GRCh38)
Location 22:26838722-26838744
Sequence TTATCTCTGTTTAACACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181991264_1181991266 -5 Left 1181991264 22:26838722-26838744 CCTCCTGTGTTAAACAGAGATAA No data
Right 1181991266 22:26838740-26838762 GATAATGAGAATTAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181991264 Original CRISPR TTATCTCTGTTTAACACAGG AGG (reversed) Intergenic
No off target data available for this crispr