ID: 1181991525

View in Genome Browser
Species Human (GRCh38)
Location 22:26840515-26840537
Sequence CTCTGGGCCTGGCACACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181991525_1181991530 -10 Left 1181991525 22:26840515-26840537 CCTCCTGTGTGCCAGGCCCAGAG No data
Right 1181991530 22:26840528-26840550 AGGCCCAGAGCTAGGCACCAGGG No data
1181991525_1181991534 26 Left 1181991525 22:26840515-26840537 CCTCCTGTGTGCCAGGCCCAGAG No data
Right 1181991534 22:26840564-26840586 CAGACTTTGTCCTGTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181991525 Original CRISPR CTCTGGGCCTGGCACACAGG AGG (reversed) Intergenic
No off target data available for this crispr