ID: 1181992567

View in Genome Browser
Species Human (GRCh38)
Location 22:26848510-26848532
Sequence ACAGGTGAGCAGAGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181992561_1181992567 6 Left 1181992561 22:26848481-26848503 CCTGATGAAATGAATACAAAAGG No data
Right 1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG No data
1181992560_1181992567 13 Left 1181992560 22:26848474-26848496 CCAGTAGCCTGATGAAATGAATA No data
Right 1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181992567 Original CRISPR ACAGGTGAGCAGAGGGCTGA GGG Intergenic
No off target data available for this crispr