ID: 1181992663

View in Genome Browser
Species Human (GRCh38)
Location 22:26849356-26849378
Sequence CTAGGAGTATGTGTGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181992659_1181992663 -5 Left 1181992659 22:26849338-26849360 CCATCTCGTCTTGAAACTCTAGG No data
Right 1181992663 22:26849356-26849378 CTAGGAGTATGTGTGGAAGTGGG No data
1181992658_1181992663 -4 Left 1181992658 22:26849337-26849359 CCCATCTCGTCTTGAAACTCTAG No data
Right 1181992663 22:26849356-26849378 CTAGGAGTATGTGTGGAAGTGGG No data
1181992657_1181992663 12 Left 1181992657 22:26849321-26849343 CCTTCGTTTATGTCTGCCCATCT No data
Right 1181992663 22:26849356-26849378 CTAGGAGTATGTGTGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181992663 Original CRISPR CTAGGAGTATGTGTGGAAGT GGG Intergenic
No off target data available for this crispr