ID: 1181993401

View in Genome Browser
Species Human (GRCh38)
Location 22:26855668-26855690
Sequence CCACCCTAGATGGGGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181993401_1181993406 -6 Left 1181993401 22:26855668-26855690 CCTAATTTCCCCATCTAGGGTGG No data
Right 1181993406 22:26855685-26855707 GGGTGGAAGTTTTATTAAAGAGG No data
1181993401_1181993408 0 Left 1181993401 22:26855668-26855690 CCTAATTTCCCCATCTAGGGTGG No data
Right 1181993408 22:26855691-26855713 AAGTTTTATTAAAGAGGAGGAGG No data
1181993401_1181993409 1 Left 1181993401 22:26855668-26855690 CCTAATTTCCCCATCTAGGGTGG No data
Right 1181993409 22:26855692-26855714 AGTTTTATTAAAGAGGAGGAGGG No data
1181993401_1181993407 -3 Left 1181993401 22:26855668-26855690 CCTAATTTCCCCATCTAGGGTGG No data
Right 1181993407 22:26855688-26855710 TGGAAGTTTTATTAAAGAGGAGG No data
1181993401_1181993410 25 Left 1181993401 22:26855668-26855690 CCTAATTTCCCCATCTAGGGTGG No data
Right 1181993410 22:26855716-26855738 GTTTTGAAATCAAACTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181993401 Original CRISPR CCACCCTAGATGGGGAAATT AGG (reversed) Intergenic
No off target data available for this crispr