ID: 1182000886

View in Genome Browser
Species Human (GRCh38)
Location 22:26918963-26918985
Sequence CTTGCATGGCAGAGGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182000876_1182000886 29 Left 1182000876 22:26918911-26918933 CCTCGGAAGTGAGAGGGAAGGGA No data
Right 1182000886 22:26918963-26918985 CTTGCATGGCAGAGGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182000886 Original CRISPR CTTGCATGGCAGAGGAGACC TGG Intergenic
No off target data available for this crispr