ID: 1182002075

View in Genome Browser
Species Human (GRCh38)
Location 22:26927789-26927811
Sequence GGGCACTCCTGCTGCAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182002075_1182002082 12 Left 1182002075 22:26927789-26927811 CCAGGATTGCAGCAGGAGTGCCC No data
Right 1182002082 22:26927824-26927846 TTATGGGGCCAGCCTGTTCTTGG No data
1182002075_1182002077 -5 Left 1182002075 22:26927789-26927811 CCAGGATTGCAGCAGGAGTGCCC No data
Right 1182002077 22:26927807-26927829 TGCCCGACAGAGAGGCGTTATGG No data
1182002075_1182002080 -3 Left 1182002075 22:26927789-26927811 CCAGGATTGCAGCAGGAGTGCCC No data
Right 1182002080 22:26927809-26927831 CCCGACAGAGAGGCGTTATGGGG No data
1182002075_1182002085 24 Left 1182002075 22:26927789-26927811 CCAGGATTGCAGCAGGAGTGCCC No data
Right 1182002085 22:26927836-26927858 CCTGTTCTTGGCCAGAAACATGG No data
1182002075_1182002078 -4 Left 1182002075 22:26927789-26927811 CCAGGATTGCAGCAGGAGTGCCC No data
Right 1182002078 22:26927808-26927830 GCCCGACAGAGAGGCGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182002075 Original CRISPR GGGCACTCCTGCTGCAATCC TGG (reversed) Intergenic
No off target data available for this crispr