ID: 1182002080

View in Genome Browser
Species Human (GRCh38)
Location 22:26927809-26927831
Sequence CCCGACAGAGAGGCGTTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182002075_1182002080 -3 Left 1182002075 22:26927789-26927811 CCAGGATTGCAGCAGGAGTGCCC No data
Right 1182002080 22:26927809-26927831 CCCGACAGAGAGGCGTTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182002080 Original CRISPR CCCGACAGAGAGGCGTTATG GGG Intergenic
No off target data available for this crispr