ID: 1182003627

View in Genome Browser
Species Human (GRCh38)
Location 22:26941139-26941161
Sequence GCCTTGCATGCCCACGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182003627_1182003630 5 Left 1182003627 22:26941139-26941161 CCCCAGACGTGGGCATGCAAGGC No data
Right 1182003630 22:26941167-26941189 GTGAAGTTCTGACAAGAAAATGG No data
1182003627_1182003631 25 Left 1182003627 22:26941139-26941161 CCCCAGACGTGGGCATGCAAGGC No data
Right 1182003631 22:26941187-26941209 TGGACATCCTTGAAAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182003627 Original CRISPR GCCTTGCATGCCCACGTCTG GGG (reversed) Intergenic
No off target data available for this crispr