ID: 1182004093

View in Genome Browser
Species Human (GRCh38)
Location 22:26944683-26944705
Sequence AGAAGGACCCTTGTGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182004087_1182004093 8 Left 1182004087 22:26944652-26944674 CCTGCTAACTCTGCTCTTCTTGC No data
Right 1182004093 22:26944683-26944705 AGAAGGACCCTTGTGATTGCAGG No data
1182004086_1182004093 22 Left 1182004086 22:26944638-26944660 CCACAGTCACGTCTCCTGCTAAC No data
Right 1182004093 22:26944683-26944705 AGAAGGACCCTTGTGATTGCAGG No data
1182004085_1182004093 25 Left 1182004085 22:26944635-26944657 CCTCCACAGTCACGTCTCCTGCT No data
Right 1182004093 22:26944683-26944705 AGAAGGACCCTTGTGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182004093 Original CRISPR AGAAGGACCCTTGTGATTGC AGG Intergenic
No off target data available for this crispr